ID: 928276018

View in Genome Browser
Species Human (GRCh38)
Location 2:29900611-29900633
Sequence TCTGACTGTCATTTTGACTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928276018_928276019 -2 Left 928276018 2:29900611-29900633 CCGCAGTCAAAATGACAGTCAGA 0: 1
1: 0
2: 2
3: 18
4: 228
Right 928276019 2:29900632-29900654 GAAGCAGTAACCAGCAAACATGG 0: 1
1: 0
2: 1
3: 22
4: 213
928276018_928276024 22 Left 928276018 2:29900611-29900633 CCGCAGTCAAAATGACAGTCAGA 0: 1
1: 0
2: 2
3: 18
4: 228
Right 928276024 2:29900656-29900678 CCATCTACACGCCCTTGACTGGG 0: 1
1: 0
2: 0
3: 4
4: 77
928276018_928276022 21 Left 928276018 2:29900611-29900633 CCGCAGTCAAAATGACAGTCAGA 0: 1
1: 0
2: 2
3: 18
4: 228
Right 928276022 2:29900655-29900677 GCCATCTACACGCCCTTGACTGG 0: 1
1: 0
2: 0
3: 1
4: 38
928276018_928276020 -1 Left 928276018 2:29900611-29900633 CCGCAGTCAAAATGACAGTCAGA 0: 1
1: 0
2: 2
3: 18
4: 228
Right 928276020 2:29900633-29900655 AAGCAGTAACCAGCAAACATGGG 0: 1
1: 0
2: 1
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928276018 Original CRISPR TCTGACTGTCATTTTGACTG CGG (reversed) Intronic