ID: 928276019

View in Genome Browser
Species Human (GRCh38)
Location 2:29900632-29900654
Sequence GAAGCAGTAACCAGCAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928276018_928276019 -2 Left 928276018 2:29900611-29900633 CCGCAGTCAAAATGACAGTCAGA 0: 1
1: 0
2: 2
3: 18
4: 228
Right 928276019 2:29900632-29900654 GAAGCAGTAACCAGCAAACATGG 0: 1
1: 0
2: 1
3: 22
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928276019 Original CRISPR GAAGCAGTAACCAGCAAACA TGG Intronic