ID: 928276020

View in Genome Browser
Species Human (GRCh38)
Location 2:29900633-29900655
Sequence AAGCAGTAACCAGCAAACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928276018_928276020 -1 Left 928276018 2:29900611-29900633 CCGCAGTCAAAATGACAGTCAGA 0: 1
1: 0
2: 2
3: 18
4: 228
Right 928276020 2:29900633-29900655 AAGCAGTAACCAGCAAACATGGG 0: 1
1: 0
2: 1
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928276020 Original CRISPR AAGCAGTAACCAGCAAACAT GGG Intronic