ID: 928276022 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:29900655-29900677 |
| Sequence | GCCATCTACACGCCCTTGAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 40 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 38} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 928276021_928276022 | -10 | Left | 928276021 | 2:29900642-29900664 | CCAGCAAACATGGGCCATCTACA | 0: 1 1: 0 2: 0 3: 7 4: 76 |
||
| Right | 928276022 | 2:29900655-29900677 | GCCATCTACACGCCCTTGACTGG | 0: 1 1: 0 2: 0 3: 1 4: 38 |
||||
| 928276018_928276022 | 21 | Left | 928276018 | 2:29900611-29900633 | CCGCAGTCAAAATGACAGTCAGA | 0: 1 1: 0 2: 2 3: 18 4: 228 |
||
| Right | 928276022 | 2:29900655-29900677 | GCCATCTACACGCCCTTGACTGG | 0: 1 1: 0 2: 0 3: 1 4: 38 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 928276022 | Original CRISPR | GCCATCTACACGCCCTTGAC TGG | Intronic | ||