ID: 928276022

View in Genome Browser
Species Human (GRCh38)
Location 2:29900655-29900677
Sequence GCCATCTACACGCCCTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928276021_928276022 -10 Left 928276021 2:29900642-29900664 CCAGCAAACATGGGCCATCTACA 0: 1
1: 0
2: 0
3: 7
4: 76
Right 928276022 2:29900655-29900677 GCCATCTACACGCCCTTGACTGG 0: 1
1: 0
2: 0
3: 1
4: 38
928276018_928276022 21 Left 928276018 2:29900611-29900633 CCGCAGTCAAAATGACAGTCAGA 0: 1
1: 0
2: 2
3: 18
4: 228
Right 928276022 2:29900655-29900677 GCCATCTACACGCCCTTGACTGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928276022 Original CRISPR GCCATCTACACGCCCTTGAC TGG Intronic