ID: 928276024

View in Genome Browser
Species Human (GRCh38)
Location 2:29900656-29900678
Sequence CCATCTACACGCCCTTGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928276021_928276024 -9 Left 928276021 2:29900642-29900664 CCAGCAAACATGGGCCATCTACA 0: 1
1: 0
2: 0
3: 7
4: 76
Right 928276024 2:29900656-29900678 CCATCTACACGCCCTTGACTGGG 0: 1
1: 0
2: 0
3: 4
4: 77
928276018_928276024 22 Left 928276018 2:29900611-29900633 CCGCAGTCAAAATGACAGTCAGA 0: 1
1: 0
2: 2
3: 18
4: 228
Right 928276024 2:29900656-29900678 CCATCTACACGCCCTTGACTGGG 0: 1
1: 0
2: 0
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928276024 Original CRISPR CCATCTACACGCCCTTGACT GGG Intronic
902653304 1:17850955-17850977 CCATCCACACACGATTGACTGGG - Intergenic
911061498 1:93751807-93751829 CCAGCCACACGCCCTTGTGTTGG - Intronic
912270999 1:108209090-108209112 TTATCTATAAGCCCTTGACTGGG + Intergenic
916612763 1:166409552-166409574 TTATCTACAAGCCCCTGACTGGG + Intergenic
917091773 1:171360030-171360052 TTATCTACAAGCCCCTGACTGGG - Intergenic
918167205 1:181961571-181961593 CTATCTATAAGCCCCTGACTGGG + Intergenic
1070814226 10:79312967-79312989 CCACCTCCACACCCTTGGCTTGG + Exonic
1072297645 10:94026804-94026826 CCAGATACACACCCTTCACTAGG - Intronic
1074795471 10:116938810-116938832 TTATCTACAAGCCCCTGACTGGG + Intronic
1083507066 11:63167661-63167683 TTATCTATAAGCCCTTGACTGGG - Intronic
1084673578 11:70621697-70621719 CCTTCTACACTCACTTGCCTGGG - Intronic
1090688903 11:129156572-129156594 TCATCTACAAGCCCCTGACTGGG - Intronic
1092389870 12:8067060-8067082 CCACCTACCTGCCTTTGACTAGG - Intergenic
1092440436 12:8496402-8496424 TTATCTACAAGCCCCTGACTGGG - Intergenic
1093545011 12:20336256-20336278 TTATCTATACGCCCCTGACTGGG + Intergenic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1108599899 13:51983410-51983432 TCATCTATAAGCCCCTGACTGGG - Intronic
1109891192 13:68617123-68617145 TGATCTACAAGCCCTTGACTGGG - Intergenic
1117182172 14:53202020-53202042 CCCTCTACAAGCCCTTTATTTGG - Intergenic
1122301351 14:100732922-100732944 CCAACTACAGGCCCAGGACTGGG - Intronic
1124396807 15:29309430-29309452 TCATCAACACACACTTGACTTGG - Intronic
1129757552 15:78107650-78107672 CGATCTGCACGCCCCTGTCTTGG + Intronic
1143784882 17:9248718-9248740 TCATCTCCACGCCCTAGACAAGG + Intergenic
1147302505 17:39541149-39541171 CCATCTACACACAGTTGAGTTGG + Intronic
1148981067 17:51575202-51575224 TTATCTATAAGCCCTTGACTAGG - Intergenic
1168653682 19:58111269-58111291 CCATCCACATGCTCTTGTCTTGG + Intronic
928276024 2:29900656-29900678 CCATCTACACGCCCTTGACTGGG + Intronic
936640239 2:114303944-114303966 TTATCTATAAGCCCTTGACTGGG + Intergenic
940757971 2:157704979-157705001 TGATCTATAAGCCCTTGACTGGG - Intergenic
940999052 2:160181483-160181505 TCATCTAAAAGCCCCTGACTGGG - Intronic
942101476 2:172588590-172588612 ACATCTACATGCCCTTAACAAGG + Intronic
942576949 2:177373848-177373870 TTATCTACAAGCCCCTGACTGGG + Intronic
943147659 2:184065807-184065829 TTATCTATAAGCCCTTGACTAGG + Intergenic
1170133945 20:13052888-13052910 CCATCTATAAACCCCTGACTGGG - Intronic
1171000886 20:21414330-21414352 TTATCTATACGCCCCTGACTGGG - Intergenic
1172515226 20:35528587-35528609 CCATCTCAAAGCCCTGGACTTGG + Intronic
1173738162 20:45376293-45376315 CTCTCTCCACGCCCTTGGCTAGG - Intronic
1173884195 20:46442378-46442400 CAATCTAGATGCCCTTCACTGGG - Intergenic
1177694608 21:24555331-24555353 TCATCTATAAGCCCCTGACTGGG - Intergenic
1178396884 21:32250674-32250696 CCATCTAGACGCCCTTGGCCAGG + Intergenic
1179990300 21:44944761-44944783 CCATCTACAGGCCCCAGACCCGG - Intronic
1182204524 22:28610083-28610105 TTATCTATAAGCCCTTGACTGGG - Intronic
950560639 3:13719624-13719646 CTATCTACAGCCCCTGGACTAGG + Intergenic
951676405 3:25246966-25246988 TCATCTATAAGCCCCTGACTAGG + Intronic
957474874 3:80709927-80709949 TTATCTACAAGCCCCTGACTGGG - Intergenic
958586281 3:96091687-96091709 CTATCTATAAGCCCCTGACTGGG - Intergenic
963910687 3:150815184-150815206 CCATCTACAGCCCCTTGAAAAGG - Intergenic
964010406 3:151885637-151885659 TTATCTACAAGCCCCTGACTGGG - Intergenic
964135160 3:153337533-153337555 AAATCTCCACGCCCTTGTCTAGG - Intergenic
964135164 3:153337556-153337578 AAATCTCCACGCCCTTGTCTAGG - Intergenic
978477224 4:109144541-109144563 TCATCTATAAGCCCCTGACTAGG + Intronic
979421427 4:120509608-120509630 CGATCTATAAGCCCCTGACTGGG - Intergenic
980223271 4:129947610-129947632 TCATCTATAAGCCCCTGACTGGG + Intergenic
981443506 4:144809360-144809382 TTATCTACAAGCCCCTGACTGGG - Intergenic
987924048 5:24317612-24317634 TTATCTACAAGCCCCTGACTGGG + Intergenic
988402142 5:30775931-30775953 TTATCTATATGCCCTTGACTGGG - Intergenic
988578309 5:32446995-32447017 GCACCTACTTGCCCTTGACTTGG + Intergenic
988766988 5:34388821-34388843 TTATCTACAAGCCCCTGACTGGG + Intergenic
989320681 5:40130696-40130718 TTATCTACAAGCCCCTGACTGGG + Intergenic
992925195 5:81576566-81576588 CCAACTAAAAGCTCTTGACTGGG + Intronic
992976867 5:82129988-82130010 TCATCTATAAGCCCCTGACTGGG + Intronic
995398669 5:111716836-111716858 TTATCTACAAGCCCCTGACTGGG + Intronic
1003713471 6:8619457-8619479 TCATCTATAAGCCCCTGACTGGG + Intergenic
1006477182 6:34263933-34263955 CCATCTTCACTTCCTTGAGTAGG + Intergenic
1008750382 6:54726708-54726730 CCATCTACACGAACTTTACAAGG - Intergenic
1009945326 6:70336271-70336293 TCATCTATAAGCCCCTGACTGGG + Intergenic
1016893127 6:149026624-149026646 CCCTCTATAAACCCTTGACTTGG + Intronic
1021447828 7:20752219-20752241 CCATCTACACATTCTTGTCTAGG + Intronic
1031015659 7:116573732-116573754 CCTTCCACAGCCCCTTGACTGGG - Intergenic
1035710790 8:1712374-1712396 TTATCTACAAGCCCCTGACTGGG - Intergenic
1039359853 8:36864305-36864327 CCATTTATAGACCCTTGACTAGG - Intronic
1050300471 9:4253258-4253280 TTATCTACAAGCCCCTGACTGGG + Intronic
1051814352 9:21087704-21087726 CTATCTATAAGCCCTTGACTGGG - Intergenic
1052017471 9:23485908-23485930 CCAATTACACCCCCTTCACTGGG + Intergenic
1056176749 9:84043726-84043748 CAAGCTATAAGCCCTTGACTGGG + Intergenic
1058954672 9:109934541-109934563 CCCTCTGCACGCTCTTCACTTGG + Intronic
1190943935 X:55072714-55072736 TCATCTATATGCCCCTGACTGGG + Intergenic
1191024307 X:55896889-55896911 TTATCTATAAGCCCTTGACTGGG - Intergenic
1191133258 X:57037678-57037700 TCATCTATAAGCCCCTGACTGGG + Intergenic
1198002234 X:132451314-132451336 TCATCTATAAGCCCCTGACTGGG + Intronic
1199399489 X:147380587-147380609 CCATCTATATGCCCTTTATTTGG + Intergenic
1200732550 Y:6758284-6758306 TTATCTATATGCCCTTGACTGGG + Intergenic