ID: 928281319

View in Genome Browser
Species Human (GRCh38)
Location 2:29948865-29948887
Sequence TCCCACTAACTGAAACGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928281314_928281319 11 Left 928281314 2:29948831-29948853 CCACTGACAGGAGCAAAAATCCG No data
Right 928281319 2:29948865-29948887 TCCCACTAACTGAAACGTCATGG No data
928281313_928281319 12 Left 928281313 2:29948830-29948852 CCCACTGACAGGAGCAAAAATCC No data
Right 928281319 2:29948865-29948887 TCCCACTAACTGAAACGTCATGG No data
928281312_928281319 15 Left 928281312 2:29948827-29948849 CCTCCCACTGACAGGAGCAAAAA No data
Right 928281319 2:29948865-29948887 TCCCACTAACTGAAACGTCATGG No data
928281316_928281319 -9 Left 928281316 2:29948851-29948873 CCGGCTCTCCAGCCTCCCACTAA No data
Right 928281319 2:29948865-29948887 TCCCACTAACTGAAACGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928281319 Original CRISPR TCCCACTAACTGAAACGTCA TGG Intergenic
No off target data available for this crispr