ID: 928283505

View in Genome Browser
Species Human (GRCh38)
Location 2:29969161-29969183
Sequence TGCATTCCGCACTTTGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928283505_928283512 19 Left 928283505 2:29969161-29969183 CCGTCTTCAAAGTGCGGAATGCA No data
Right 928283512 2:29969203-29969225 TCCCTGAAATACTTTTAGAAAGG No data
928283505_928283510 -7 Left 928283505 2:29969161-29969183 CCGTCTTCAAAGTGCGGAATGCA No data
Right 928283510 2:29969177-29969199 GAATGCAAACATCTGGAAGGGGG No data
928283505_928283508 -9 Left 928283505 2:29969161-29969183 CCGTCTTCAAAGTGCGGAATGCA No data
Right 928283508 2:29969175-29969197 CGGAATGCAAACATCTGGAAGGG No data
928283505_928283507 -10 Left 928283505 2:29969161-29969183 CCGTCTTCAAAGTGCGGAATGCA No data
Right 928283507 2:29969174-29969196 GCGGAATGCAAACATCTGGAAGG No data
928283505_928283509 -8 Left 928283505 2:29969161-29969183 CCGTCTTCAAAGTGCGGAATGCA No data
Right 928283509 2:29969176-29969198 GGAATGCAAACATCTGGAAGGGG No data
928283505_928283511 -4 Left 928283505 2:29969161-29969183 CCGTCTTCAAAGTGCGGAATGCA No data
Right 928283511 2:29969180-29969202 TGCAAACATCTGGAAGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928283505 Original CRISPR TGCATTCCGCACTTTGAAGA CGG (reversed) Intergenic
No off target data available for this crispr