ID: 928283511

View in Genome Browser
Species Human (GRCh38)
Location 2:29969180-29969202
Sequence TGCAAACATCTGGAAGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928283504_928283511 0 Left 928283504 2:29969157-29969179 CCAGCCGTCTTCAAAGTGCGGAA No data
Right 928283511 2:29969180-29969202 TGCAAACATCTGGAAGGGGGTGG No data
928283505_928283511 -4 Left 928283505 2:29969161-29969183 CCGTCTTCAAAGTGCGGAATGCA No data
Right 928283511 2:29969180-29969202 TGCAAACATCTGGAAGGGGGTGG No data
928283502_928283511 23 Left 928283502 2:29969134-29969156 CCTGACACTGATTCTGATCTTAT No data
Right 928283511 2:29969180-29969202 TGCAAACATCTGGAAGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928283511 Original CRISPR TGCAAACATCTGGAAGGGGG TGG Intergenic
No off target data available for this crispr