ID: 928286056

View in Genome Browser
Species Human (GRCh38)
Location 2:29990911-29990933
Sequence CTCCAACAGCAGCCAGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928286045_928286056 17 Left 928286045 2:29990871-29990893 CCTAGAGGCAGAGTGGATGGTGG No data
Right 928286056 2:29990911-29990933 CTCCAACAGCAGCCAGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928286056 Original CRISPR CTCCAACAGCAGCCAGGAAA GGG Intergenic
No off target data available for this crispr