ID: 928286257

View in Genome Browser
Species Human (GRCh38)
Location 2:29992493-29992515
Sequence CTGAGTTTTGCCAGGTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928286257_928286260 1 Left 928286257 2:29992493-29992515 CCTGCTTACCTGGCAAAACTCAG No data
Right 928286260 2:29992517-29992539 TTCCATTGACACCACTGGAGAGG No data
928286257_928286259 -4 Left 928286257 2:29992493-29992515 CCTGCTTACCTGGCAAAACTCAG No data
Right 928286259 2:29992512-29992534 TCAGATTCCATTGACACCACTGG No data
928286257_928286263 25 Left 928286257 2:29992493-29992515 CCTGCTTACCTGGCAAAACTCAG No data
Right 928286263 2:29992541-29992563 GAGTGACTTTCCCCCTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928286257 Original CRISPR CTGAGTTTTGCCAGGTAAGC AGG (reversed) Intergenic
No off target data available for this crispr