ID: 928289933

View in Genome Browser
Species Human (GRCh38)
Location 2:30028121-30028143
Sequence TGAGTTGCAAAATAAAATCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928289933_928289934 15 Left 928289933 2:30028121-30028143 CCGGGATTTTATTTTGCAACTCA No data
Right 928289934 2:30028159-30028181 TATCCCAGTGTTCATATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928289933 Original CRISPR TGAGTTGCAAAATAAAATCC CGG (reversed) Intergenic
No off target data available for this crispr