ID: 928293432

View in Genome Browser
Species Human (GRCh38)
Location 2:30060562-30060584
Sequence CATGCCATGCTGCAGGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928293432_928293442 20 Left 928293432 2:30060562-30060584 CCATTCCCCTGCAGCATGGCATG No data
Right 928293442 2:30060605-30060627 TAGGGAAAACACAGTGATTCTGG No data
928293432_928293440 1 Left 928293432 2:30060562-30060584 CCATTCCCCTGCAGCATGGCATG No data
Right 928293440 2:30060586-30060608 AGAATCTGTGTGCTTGGGGTAGG No data
928293432_928293444 27 Left 928293432 2:30060562-30060584 CCATTCCCCTGCAGCATGGCATG No data
Right 928293444 2:30060612-30060634 AACACAGTGATTCTGGGATCCGG No data
928293432_928293437 -5 Left 928293432 2:30060562-30060584 CCATTCCCCTGCAGCATGGCATG No data
Right 928293437 2:30060580-30060602 GCATGGAGAATCTGTGTGCTTGG No data
928293432_928293438 -4 Left 928293432 2:30060562-30060584 CCATTCCCCTGCAGCATGGCATG No data
Right 928293438 2:30060581-30060603 CATGGAGAATCTGTGTGCTTGGG No data
928293432_928293441 2 Left 928293432 2:30060562-30060584 CCATTCCCCTGCAGCATGGCATG No data
Right 928293441 2:30060587-30060609 GAATCTGTGTGCTTGGGGTAGGG No data
928293432_928293443 21 Left 928293432 2:30060562-30060584 CCATTCCCCTGCAGCATGGCATG No data
Right 928293443 2:30060606-30060628 AGGGAAAACACAGTGATTCTGGG No data
928293432_928293439 -3 Left 928293432 2:30060562-30060584 CCATTCCCCTGCAGCATGGCATG No data
Right 928293439 2:30060582-30060604 ATGGAGAATCTGTGTGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928293432 Original CRISPR CATGCCATGCTGCAGGGGAA TGG (reversed) Intergenic
No off target data available for this crispr