ID: 928294360

View in Genome Browser
Species Human (GRCh38)
Location 2:30069962-30069984
Sequence GTGGTAAAGAGCAGATTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928294353_928294360 3 Left 928294353 2:30069936-30069958 CCATGGGGAACCACTGAAGTAGG No data
Right 928294360 2:30069962-30069984 GTGGTAAAGAGCAGATTTGTGGG No data
928294358_928294360 -7 Left 928294358 2:30069946-30069968 CCACTGAAGTAGGGGAGTGGTAA No data
Right 928294360 2:30069962-30069984 GTGGTAAAGAGCAGATTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928294360 Original CRISPR GTGGTAAAGAGCAGATTTGT GGG Intergenic
No off target data available for this crispr