ID: 928296706

View in Genome Browser
Species Human (GRCh38)
Location 2:30090060-30090082
Sequence TCAGCTCAGCCTAGCTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928296703_928296706 -5 Left 928296703 2:30090042-30090064 CCTTTCCAGCTTCTCCATTCAGC No data
Right 928296706 2:30090060-30090082 TCAGCTCAGCCTAGCTTCTCAGG No data
928296697_928296706 28 Left 928296697 2:30090009-30090031 CCCTAGTCAGACAAGCTTCCCTC No data
Right 928296706 2:30090060-30090082 TCAGCTCAGCCTAGCTTCTCAGG No data
928296698_928296706 27 Left 928296698 2:30090010-30090032 CCTAGTCAGACAAGCTTCCCTCA No data
Right 928296706 2:30090060-30090082 TCAGCTCAGCCTAGCTTCTCAGG No data
928296704_928296706 -10 Left 928296704 2:30090047-30090069 CCAGCTTCTCCATTCAGCTCAGC No data
Right 928296706 2:30090060-30090082 TCAGCTCAGCCTAGCTTCTCAGG No data
928296702_928296706 -4 Left 928296702 2:30090041-30090063 CCCTTTCCAGCTTCTCCATTCAG No data
Right 928296706 2:30090060-30090082 TCAGCTCAGCCTAGCTTCTCAGG No data
928296700_928296706 10 Left 928296700 2:30090027-30090049 CCCTCAGGCTCTCACCCTTTCCA No data
Right 928296706 2:30090060-30090082 TCAGCTCAGCCTAGCTTCTCAGG No data
928296701_928296706 9 Left 928296701 2:30090028-30090050 CCTCAGGCTCTCACCCTTTCCAG No data
Right 928296706 2:30090060-30090082 TCAGCTCAGCCTAGCTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928296706 Original CRISPR TCAGCTCAGCCTAGCTTCTC AGG Intergenic
No off target data available for this crispr