ID: 928296811

View in Genome Browser
Species Human (GRCh38)
Location 2:30090835-30090857
Sequence ACTGATGTGCATCCTTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928296811_928296813 -7 Left 928296811 2:30090835-30090857 CCTTCCAAAGGATGCACATCAGT No data
Right 928296813 2:30090851-30090873 CATCAGTCAGCATCACAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928296811 Original CRISPR ACTGATGTGCATCCTTTGGA AGG (reversed) Intergenic
No off target data available for this crispr