ID: 928298926

View in Genome Browser
Species Human (GRCh38)
Location 2:30108819-30108841
Sequence TCATTCTGTGACTGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928298921_928298926 -5 Left 928298921 2:30108801-30108823 CCAGCCTGGCTCACATGCTCATT No data
Right 928298926 2:30108819-30108841 TCATTCTGTGACTGGCTGGAGGG No data
928298920_928298926 -4 Left 928298920 2:30108800-30108822 CCCAGCCTGGCTCACATGCTCAT No data
Right 928298926 2:30108819-30108841 TCATTCTGTGACTGGCTGGAGGG No data
928298922_928298926 -9 Left 928298922 2:30108805-30108827 CCTGGCTCACATGCTCATTCTGT No data
Right 928298926 2:30108819-30108841 TCATTCTGTGACTGGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928298926 Original CRISPR TCATTCTGTGACTGGCTGGA GGG Intergenic
No off target data available for this crispr