ID: 928299927

View in Genome Browser
Species Human (GRCh38)
Location 2:30116099-30116121
Sequence CAGGTAAAAACCAGAATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928299927_928299935 5 Left 928299927 2:30116099-30116121 CCAACCATTCTGGTTTTTACCTG No data
Right 928299935 2:30116127-30116149 GAGGGGACTGCCTACGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928299927 Original CRISPR CAGGTAAAAACCAGAATGGT TGG (reversed) Intergenic
No off target data available for this crispr