ID: 928304306

View in Genome Browser
Species Human (GRCh38)
Location 2:30153870-30153892
Sequence GAGAAAAAATAGATGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 531
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 489}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928304304_928304306 -1 Left 928304304 2:30153848-30153870 CCAGTAAAAATACTTGGGTAAAG 0: 1
1: 0
2: 0
3: 16
4: 168
Right 928304306 2:30153870-30153892 GAGAAAAAATAGATGGAATCAGG 0: 1
1: 0
2: 1
3: 40
4: 489

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928304306 Original CRISPR GAGAAAAAATAGATGGAATC AGG Intronic
900587795 1:3441585-3441607 GAGGAAAAATCTATGGAATAAGG + Intergenic
900994929 1:6115937-6115959 AAGAAAATATACATGGAAGCTGG + Intronic
902533626 1:17106284-17106306 GAGAACAAATGGATGTGATCTGG + Intronic
903537463 1:24076474-24076496 GAAATAAAACAGATGGAACCTGG - Intronic
903760078 1:25691684-25691706 GGGAAAAAACAGGGGGAATCAGG - Intronic
903843843 1:26264904-26264926 GAGAGAGAATAGTTTGAATCTGG - Intronic
903960510 1:27054205-27054227 GGAAAAAAAAAGATGGTATCAGG - Intergenic
904750142 1:32736881-32736903 GAGGAAAAATGGGTGGAATTAGG + Intergenic
905419336 1:37829104-37829126 AAGAAAAAAAAGAGAGAATCAGG - Intronic
905432567 1:37935201-37935223 AAAAAAAAAAAGATGGAGTCTGG + Intronic
905587224 1:39130050-39130072 GAGAAAAAAAAAATGGAGTGGGG - Intronic
905763340 1:40579486-40579508 GAAGAAAAAGAGATGGTATCTGG + Intergenic
906048984 1:42855164-42855186 AAGAAAGAGTAGATGGAATGAGG - Intergenic
906063716 1:42964886-42964908 TTGAAAAAATAAATGGAGTCAGG + Intergenic
906788475 1:48637503-48637525 GGGAACAAAGAGATAGAATCTGG - Intronic
907402757 1:54234773-54234795 AAAAAAAAAGAGATGGAGTCTGG + Intronic
907646934 1:56253652-56253674 GAGAAAAAATGGATTGAAGGAGG - Intergenic
907922810 1:58929236-58929258 TAGAGAAAATAGAGGTAATCAGG + Intergenic
908382349 1:63608689-63608711 TAGAAAACTCAGATGGAATCAGG + Intronic
908405624 1:63811556-63811578 GGGAAAAAAAAGATGGAGTGAGG - Intronic
909692707 1:78427346-78427368 GAGATAAAATGGATAGTATCTGG + Intronic
909722369 1:78790263-78790285 GAGAAAAAGCAGATGAATTCTGG - Intergenic
910255351 1:85242123-85242145 GAGACAGAATAGCTTGAATCAGG - Intergenic
911801424 1:102143535-102143557 GAAGAAAAATAGATGAAATCAGG - Intergenic
912225104 1:107724475-107724497 GACAAAAAATACATGGCCTCTGG + Intronic
912423797 1:109567941-109567963 GAGAAAAAAGAGAAGGACTCAGG + Intronic
914943621 1:152044518-152044540 ATGAAAAAATAGCTGGAATTAGG - Intronic
915016074 1:152735281-152735303 GACAAAAAAGAGATAGAACCAGG - Intergenic
915659159 1:157388204-157388226 GAGAAAGAATCAATGGAATAAGG - Intergenic
915776180 1:158489786-158489808 GAAAAAAAATAGATTGAATGTGG + Intergenic
915838805 1:159199312-159199334 GAGAAAAGAAAGAAGGAAACAGG + Intronic
916600241 1:166286351-166286373 GAGATCAAATAAATGGATTCTGG - Intergenic
916690281 1:167183681-167183703 GAGAACAAAAAGGTGGAACCAGG + Intergenic
917207086 1:172587456-172587478 GAGAAAAATTATATTGAATTTGG - Intronic
917606048 1:176630653-176630675 GAGAAAAAAAAGATGGATATAGG + Intronic
918173133 1:182017484-182017506 GTGACAATATAGATGGAATTGGG - Intergenic
918490990 1:185081382-185081404 AAAAAAAAATTGATGGAATTAGG - Intronic
918546155 1:185686497-185686519 GAGAGAAACTAGATGGTAGCTGG - Intergenic
918870396 1:189965667-189965689 GAGAAAACATATTTGTAATCTGG - Intergenic
919495970 1:198268430-198268452 AAGAAAAAATAAACAGAATCTGG - Intronic
920225459 1:204435338-204435360 AAGAAAAACTACATGGAATGAGG + Intronic
921179794 1:212623328-212623350 GAGAAAAGAGAGTTGGAAGCAGG + Intergenic
921277067 1:213531183-213531205 GAAAAGAAAGAGATGGAAACAGG - Intergenic
921957538 1:220999845-220999867 GAGAAAGTACAGATGGCATCAGG + Intergenic
922016721 1:221655697-221655719 GAGAAAAAAGAGATGTCATTTGG + Intergenic
922738069 1:228000287-228000309 GAGGAAGAGAAGATGGAATCTGG - Intergenic
923782710 1:237040032-237040054 GAGAAAAAATACATAAAATTTGG - Intergenic
923856343 1:237849202-237849224 GAAAAAAAATAGAAGGCATCCGG + Intergenic
924276743 1:242396321-242396343 GAGAAAAAATTGTTGGACACTGG + Intronic
924291498 1:242541471-242541493 GAGAAAAAATGGAGGGATGCAGG - Intergenic
1062846336 10:709241-709263 GGAAAAAAATAGATGAAATGGGG - Intergenic
1063026229 10:2181482-2181504 TAGAAAAAATAGAAGAGATCTGG + Intergenic
1063281982 10:4639809-4639831 GAGAAAATATATATCAAATCTGG + Intergenic
1064551574 10:16506573-16506595 GGCAACAAATAGATGGAATCTGG + Intronic
1064723509 10:18253854-18253876 GATACAAAATAAAAGGAATCAGG + Intronic
1066007595 10:31160227-31160249 GAGAAAAAAAAGAATGAAGCTGG - Intergenic
1066459866 10:35603683-35603705 GAGAAAAAAGACAAGGAATGGGG + Intergenic
1066540939 10:36445782-36445804 GAGAAAAAAGAGGTGAAATTAGG - Intergenic
1067518879 10:46979634-46979656 CACAAAAAAGAGATGGAATTTGG + Intronic
1067643368 10:48072200-48072222 CACAAAAAAGAGATGGAATTTGG - Intergenic
1068156291 10:53203882-53203904 AAAAAAAAAAACATGGAATCTGG + Intergenic
1068322069 10:55432560-55432582 GATAAAAATTAGATTGATTCTGG + Intronic
1068441649 10:57063275-57063297 AAGAAAAAATGGATAGAATTAGG - Intergenic
1070412703 10:76157774-76157796 GAGAAATGATAGATGAAATTAGG + Intronic
1070416420 10:76194254-76194276 GAGAAAAAGTTTTTGGAATCAGG + Intronic
1071535221 10:86423197-86423219 TAGAAAAAATACAAAGAATCAGG + Intergenic
1072464738 10:95652856-95652878 GAGAAAAAAAAGATGTAATTTGG - Intronic
1072528826 10:96299014-96299036 GAGAAAGAAGGGAAGGAATCAGG - Intergenic
1073668164 10:105556698-105556720 GAGAATACATAGCTGGCATCTGG + Intergenic
1073797733 10:107006377-107006399 GAGAATAAATAGATGGCACAGGG + Intronic
1074204246 10:111268406-111268428 AAGAAAGAATGGATGTAATCAGG - Intergenic
1074786030 10:116841509-116841531 GTTAAAAAATAGATTGAATTGGG - Intergenic
1076676756 10:132151094-132151116 GAGAATGAATAGATGGATTATGG - Intronic
1077836687 11:5932646-5932668 GAGATGAAATAGCTGGAGTCTGG - Intronic
1077948196 11:6925904-6925926 GAGAGAAAATAGAAGGAAATGGG - Intergenic
1078316546 11:10298098-10298120 AAGACGAAATAGATGGAATGCGG + Intergenic
1078598680 11:12711909-12711931 GAGAAATAAAAGATGAGATCAGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079056703 11:17212345-17212367 GAGAAAAGATAGAGGGAAGATGG + Intronic
1080313782 11:30925464-30925486 GAGAGAAAATAAAAGAAATCTGG + Intronic
1080456621 11:32425326-32425348 GAGAAAAAATGAATGAAACCAGG + Intronic
1080463809 11:32478581-32478603 GGAAAAAAAGAGATGGGATCTGG + Intergenic
1080922750 11:36725077-36725099 TAGAAAGAAGAGATGGAAACTGG + Intergenic
1081100691 11:38998189-38998211 GAAAACAAATAGACGGAATTAGG + Intergenic
1081184723 11:40028255-40028277 GACAAAAAATAGTTGGAACTTGG + Intergenic
1081781945 11:45719128-45719150 GAGAAAAAGTCCATGAAATCAGG + Intergenic
1081789986 11:45775645-45775667 GAGAAAAAATATGGGGAAGCAGG + Intergenic
1083078899 11:60070591-60070613 TAGAAAAAATATATTGAATAGGG - Exonic
1083209017 11:61171080-61171102 CAGAAAAACTAGAGGGAAGCAGG + Intergenic
1084098276 11:66927729-66927751 AAAAAAAAAAAGATAGAATCTGG + Intronic
1084662706 11:70556355-70556377 GAGAGAAAATAAATGTGATCAGG - Intronic
1086609276 11:88734912-88734934 GAGACATCATAGATGGATTCTGG + Intronic
1087264125 11:96042415-96042437 GAGAAAAAAGAGAAGGCAGCTGG - Intronic
1087536942 11:99460088-99460110 GCTTAAAAATAGATGGAATGCGG + Intronic
1087575723 11:99986654-99986676 GAGAAAAAAAGGATGGAAGTTGG - Intronic
1088097618 11:106118349-106118371 AAAAAAAAATAAATGGAATGGGG - Intergenic
1088235527 11:107718997-107719019 GAGAGAAAATAGAAGGAAGTGGG + Intronic
1090607927 11:128442871-128442893 GAAAAAAAATCAATGAAATCAGG - Intergenic
1090939639 11:131375685-131375707 CAGAAAAAATAGCTCTAATCTGG + Intronic
1091436221 12:475137-475159 GAGAAAAGAAAAAAGGAATCTGG + Intronic
1093193935 12:16107923-16107945 GAGAAATAATAGAAGGGATGAGG + Intergenic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1093542142 12:20299730-20299752 GAGAAAAGATAAATAGAAACAGG - Intergenic
1093615467 12:21217506-21217528 GAGAAGAAACGTATGGAATCTGG - Intronic
1094864084 12:34508387-34508409 GATAAAAACTAGAAGGAGTCTGG - Intergenic
1096032496 12:48433092-48433114 AACAAAAAATAGATGGTATCTGG + Intergenic
1097606282 12:61758565-61758587 TAGGAAAAATAGATGAAATCAGG - Intronic
1097695420 12:62770399-62770421 GAGAAACAAAAGCTGGATTCAGG - Intronic
1097960927 12:65531420-65531442 CAGAAAAGATAGAAGGAATAGGG + Intergenic
1098891879 12:76017698-76017720 GAGAAAAGAAAGAAGGAACCCGG + Intergenic
1099762160 12:86938116-86938138 GAGAAAAAATATATATCATCAGG + Intergenic
1100470817 12:94891317-94891339 GAGGAAAGACAGATTGAATCCGG + Intergenic
1100605453 12:96148765-96148787 CTGGAAAAATAGATGGAATGAGG + Intergenic
1101915278 12:108891119-108891141 TATAAAAAATGTATGGAATCAGG - Intronic
1102755827 12:115339423-115339445 GAGAAAGAAAAGAAGGAAACTGG - Intergenic
1103014934 12:117486861-117486883 GAGATAAAAGAGTTGGAAACAGG + Intronic
1103420831 12:120780814-120780836 GAGGCAGAATAGTTGGAATCCGG + Intronic
1104047817 12:125175415-125175437 GCAACAAAATAGAAGGAATCTGG + Intergenic
1104071765 12:125352015-125352037 CAGAAAATATAGATGGCAGCAGG - Intronic
1105798148 13:23878468-23878490 GAGACAAAATAGAAGGAAACAGG + Intronic
1106251307 13:27983644-27983666 CAGAAAAAATATATGTAATATGG - Intronic
1106396823 13:29388267-29388289 GGGAAAATAAAGATGGAGTCGGG + Intronic
1107033892 13:35880710-35880732 GAGAAAAAACAGATGCCTTCTGG - Intronic
1108477762 13:50838013-50838035 GAGAGAAAATTGATAGAAACAGG + Intronic
1108478027 13:50840709-50840731 GAGAGAAAATTGATAGAAACAGG + Intronic
1108776206 13:53768226-53768248 AAGAAAAACTGGAAGGAATCAGG + Intergenic
1108895458 13:55321417-55321439 GAGAATAAATAGATAGTATGAGG + Intergenic
1108895527 13:55322630-55322652 AAGAAAAAATAGAAGGAAGGAGG - Intergenic
1108948257 13:56051346-56051368 AAGAAAAAATTGCTGGAACCAGG - Intergenic
1109545756 13:63838479-63838501 GAGAGAAAATAGATGGCAGCTGG + Intergenic
1110528067 13:76562932-76562954 GAGAAAAAATATATTGGATGAGG + Intergenic
1110716042 13:78705239-78705261 GAGAAAAAATAAAAGAATTCTGG + Intergenic
1113090149 13:106609598-106609620 GTGAGAAAATAAATGGAATAGGG - Intergenic
1114270212 14:21096425-21096447 GAGAAAAAAATCATGGGATCAGG - Intronic
1114738439 14:25068061-25068083 GAGAAACAATTGAAGGACTCAGG - Intergenic
1114952680 14:27776367-27776389 GACAAAAAATAGAAGAAATGGGG + Intergenic
1115360137 14:32491259-32491281 GAGATAAAATAGACGTAATTTGG - Intronic
1115707267 14:36012241-36012263 GAAAAATAATAGATGTTATCAGG - Intergenic
1115953580 14:38749995-38750017 GAGAAAAAATTGTTGGAAAAAGG - Intergenic
1116067746 14:40005661-40005683 CAGAAAAAAAAAATGGTATCGGG - Intergenic
1116251524 14:42489663-42489685 AAGAAAAAGCAGATGAAATCTGG - Intergenic
1116692079 14:48121016-48121038 CAGAAAAAATAGCTTGTATCCGG + Intergenic
1117838867 14:59836538-59836560 TAGAAAAAATTGATGAAACCAGG + Intronic
1118079214 14:62339007-62339029 GAGAAAAAATAGAGGAAAAGGGG - Intergenic
1118536749 14:66774791-66774813 GAGAAAAAATAGTTGAAAAGTGG - Intronic
1118554828 14:67006386-67006408 GAGAAAAAATAGCAGCAAGCTGG - Intronic
1118583813 14:67331708-67331730 GATAAAAACTAGGTGGATTCGGG + Intronic
1118886891 14:69874929-69874951 GAGAAATAATAGAAGGAGCCTGG + Intronic
1119276284 14:73359624-73359646 GAGAAAAAGGTGTTGGAATCTGG + Intronic
1119854739 14:77891103-77891125 GAGAAAAAATAGAGGCTATCAGG - Intronic
1119965734 14:78913759-78913781 AAGAGAAAACAGATGAAATCTGG + Intronic
1119988541 14:79168374-79168396 TAGAAAAAATAGATAGTATAGGG + Intronic
1120432321 14:84434765-84434787 GAGAAAATAGAGATGCAAACTGG + Intergenic
1120487029 14:85126978-85127000 GGTAAGAAATGGATGGAATCTGG - Intergenic
1120647315 14:87089460-87089482 GAGAATAAAAAGATGGATTCTGG - Intergenic
1120697142 14:87657290-87657312 GAGAAAAGGCAGATGGCATCTGG + Intergenic
1121373473 14:93382760-93382782 AAGATAAAATGGATGGAATCTGG - Intronic
1122625079 14:103080897-103080919 GATAACAACTGGATGGAATCTGG + Intergenic
1124037396 15:26067978-26068000 GAGAAAGAGTACATGGAGTCTGG - Intergenic
1124117432 15:26858999-26859021 GAGGAAAAATAAATGGAATCGGG + Intronic
1124824290 15:33078044-33078066 GAGAAAAAGTAGAGGCAATAAGG + Intronic
1126525887 15:49653880-49653902 AAGGAAAAATAGATGGAAGATGG + Exonic
1126812553 15:52422576-52422598 GGTAAAAAGTAGATGGATTCTGG - Intronic
1127343989 15:58076118-58076140 CAGAAAAGGTACATGGAATCAGG - Intronic
1127384190 15:58453895-58453917 GAAAAAAAATGGATAGAATGTGG + Intronic
1128199966 15:65796487-65796509 TAGACAAAATAGATGGCATTTGG + Intronic
1129748784 15:78044927-78044949 GAGTAAAAATTAATGGAATTTGG + Exonic
1129974900 15:79813833-79813855 GAGATTAAATAGAAGGATTCAGG - Intergenic
1130397365 15:83514470-83514492 GAGATAAAATTGAGGGAATCTGG + Intronic
1130746872 15:86663646-86663668 GAGAAAAGAGAGAGGGAATCTGG + Intronic
1131044460 15:89302431-89302453 GAGAGAAAATAAATGGATTTAGG + Intronic
1131502798 15:92986292-92986314 TAAAAAAAAAAGATGGAAACTGG - Intronic
1134422821 16:14110675-14110697 GAGAAAAAATGGACAGAACCTGG - Intronic
1135010994 16:18878629-18878651 AAGAAAAAAAAGAAAGAATCTGG + Intronic
1137352745 16:47727925-47727947 GAGAAGAAGTGGATGGAATCTGG + Intergenic
1137777354 16:51067060-51067082 AAGAAAAAAGAGATGGTATTGGG - Intergenic
1138091077 16:54175080-54175102 CAGAAAAAATAGCTGCAAACTGG + Intergenic
1138523438 16:57586849-57586871 GAAAAAAAATTGATAGAATAAGG + Intronic
1138728840 16:59172275-59172297 GAGAGAAAATAAACGGATTCAGG - Intergenic
1138797764 16:59991044-59991066 GAGAAAAACTATATGGAGTGGGG - Intergenic
1139173983 16:64664548-64664570 GAAAAAAAATAGAGAGAATGTGG + Intergenic
1140882791 16:79214152-79214174 GAGAAAAAATAGAGGGGAAGGGG - Intergenic
1141149435 16:81553693-81553715 GAGAAAACACAAATGGCATCTGG - Intronic
1143164214 17:4889861-4889883 TAGAAAAGATAGGAGGAATCTGG - Intronic
1143267296 17:5649036-5649058 GAGCAAAAATAACTGGAAGCCGG - Intergenic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1143464659 17:7128165-7128187 AAAAAAAAATATATGGAATATGG + Intergenic
1146707699 17:35013536-35013558 GAGAAAGTATAGATGCAATAAGG - Intronic
1146798384 17:35798973-35798995 GAGAAAAGGAAGATGAAATCGGG + Intronic
1146899934 17:36577334-36577356 GACAAAATATACATGGAAACTGG - Intronic
1149226910 17:54482428-54482450 AAAAAAAAATAGATGGATTTGGG + Intergenic
1149352482 17:55805040-55805062 AAGCAAAAATTGATAGAATCAGG + Intronic
1149450776 17:56748330-56748352 AAGAGAAAATAGAGGCAATCAGG + Intergenic
1149704056 17:58679163-58679185 GAAAAAAAACAGAAGGACTCTGG + Intronic
1150768722 17:68023556-68023578 GAGAATGAATAGGTGGAATAAGG - Intergenic
1151398251 17:73839127-73839149 GAGAAAGGGTAGATGGACTCAGG + Intergenic
1151515610 17:74593026-74593048 GAGAAAAAATGAATCGATTCAGG - Exonic
1151545136 17:74788258-74788280 AAGAAAAAAGGGATGGATTCCGG + Intronic
1151794528 17:76334737-76334759 GAGAAAAAATAAAAGGTAACTGG - Intronic
1152199271 17:78935641-78935663 GAGATAAAATACAGGGAGTCTGG - Intergenic
1153148842 18:2067132-2067154 GAGAAAAAGTGGATGATATCTGG + Intergenic
1153164112 18:2242419-2242441 GAGAAACAATACATGGTTTCAGG + Intergenic
1153462469 18:5351869-5351891 GAGAGAAAATAGATGGATTTTGG + Intergenic
1153759375 18:8315947-8315969 AATAAAAAATAAATGGAACCTGG - Intronic
1153974167 18:10252359-10252381 GTGAATAGATAGATGGATTCTGG - Intergenic
1155330142 18:24707452-24707474 GAAAAAAAAAATATGGAATGGGG - Intergenic
1155712796 18:28903912-28903934 GGGAAAAAATAGATGTGATGGGG + Intergenic
1156285703 18:35693524-35693546 GAGAAAAACTATATGGAAACAGG + Intronic
1158022099 18:52855203-52855225 GAGAAAAAGTAAATAGAAACTGG - Intronic
1158286980 18:55894505-55894527 GAGAAGAAATAGACGGAGTGAGG - Intergenic
1159133292 18:64306222-64306244 GTGAATAAATAGATGGAAGGGGG + Intergenic
1159571235 18:70114528-70114550 GAGAAGAAACAGATGATATCCGG - Exonic
1159775962 18:72602925-72602947 GAAAACAAAAAGGTGGAATCAGG - Intronic
1159808226 18:72981394-72981416 GAGAAAAAAGAAGTGGAATTAGG + Intergenic
1164177289 19:22786458-22786480 AAAAAAAAATAAAAGGAATCTGG - Intergenic
1164575186 19:29401691-29401713 GTGACAAAATAGATGACATCAGG + Intergenic
1167150316 19:47705140-47705162 AAGAAAAAAAAAAGGGAATCAGG - Intergenic
1167964361 19:53131672-53131694 GAGAAAGAATAGAGGGAAGACGG - Intronic
1168571187 19:57471931-57471953 GAGAAAATATAAAAGGAATCAGG + Exonic
925205143 2:1999430-1999452 GAGAAAGAATAGACAGAAGCTGG + Intronic
925452659 2:3983148-3983170 GTGTAAAACTTGATGGAATCTGG + Intergenic
925606967 2:5669456-5669478 AAAAAAAAAAAGATGAAATCAGG - Intergenic
925622342 2:5806452-5806474 GAGAAAAAATTGAGGAAAACAGG - Intergenic
925655214 2:6139744-6139766 GAAGAAAAATAGATGCAGTCAGG - Intergenic
926483733 2:13430233-13430255 CAGAGAAAATAAATGTAATCTGG + Intergenic
928304306 2:30153870-30153892 GAGAAAAAATAGATGGAATCAGG + Intronic
928520922 2:32087975-32087997 GAGAATAAATAGCCTGAATCCGG - Intronic
928721562 2:34127088-34127110 GAGATAAAACAGAAGGCATCAGG - Intergenic
928868191 2:35943872-35943894 GAGAAAAAGTAAATAAAATCAGG + Intergenic
929288374 2:40162243-40162265 GAGAAAAGAAAGATGGATGCTGG - Intronic
929479086 2:42285575-42285597 GAAAAAAAAAAGGTGGAGTCAGG - Intronic
929732190 2:44507520-44507542 GAAAAAAATGAGATGAAATCAGG - Intronic
930247879 2:49003605-49003627 ATGAACAAATAGATGGAAGCAGG + Intronic
930380741 2:50624557-50624579 GAAGAAAAAAAGATAGAATCTGG + Intronic
930385180 2:50685426-50685448 GAGAAAAAATAGTTGTAATTTGG - Intronic
930896910 2:56457067-56457089 GTGAAAACATAGCTGGAATAAGG - Intergenic
932128428 2:69166405-69166427 GGGAAAAATGAGATGGAATATGG - Intronic
933215334 2:79623457-79623479 GGGAAGAAATAGATGGAGTGAGG - Intronic
933551399 2:83781541-83781563 AATAAAAAATAGATAGAAACAGG + Intergenic
934484584 2:94692605-94692627 GACAAAAAATAGAAGAAATGGGG - Intergenic
934508231 2:94913887-94913909 GAGGAAAGATATATGCAATCTGG - Intergenic
938178336 2:129156771-129156793 GAAAAAAAGTATATGGATTCTGG + Intergenic
938658348 2:133459188-133459210 TACAAAACATACATGGAATCTGG - Intronic
938907961 2:135856749-135856771 GATAAAGAAGAGATCGAATCGGG + Exonic
939386113 2:141500533-141500555 GAAATAAAATGGATGGAGTCTGG + Intronic
940721032 2:157281933-157281955 GAGAGAAAATAGATACATTCAGG + Intronic
941154272 2:161956550-161956572 GAGGAAAAATAGGTGCAATGGGG - Intronic
941308025 2:163894557-163894579 GATGAAAAATAGATCCAATCAGG + Intergenic
941644346 2:168024161-168024183 GAGAAGAAATGGATGGACTGTGG + Intronic
942529739 2:176896916-176896938 GAGAAAAGAAAGATGGATTAAGG + Intergenic
942880132 2:180849923-180849945 AAGAAAAAACAGACAGAATCAGG + Intergenic
943032362 2:182700821-182700843 GAGAGAAAATTGCTTGAATCTGG + Intergenic
943051714 2:182921086-182921108 GAGAAAAAATAAATATAATTTGG + Intronic
943703477 2:191011745-191011767 GAGAGAGAATAGATGCAAGCAGG - Intronic
944214273 2:197238685-197238707 AAAAAAAGATAGATGGAACCTGG - Intronic
944459310 2:199929466-199929488 GCTAAAAAATAGATGTAGTCAGG - Intronic
944718656 2:202401244-202401266 GAGTAAAATTAGATGGCATGTGG + Intronic
944780392 2:203011713-203011735 TAGAAAAACTGGATGGATTCAGG + Intronic
945247782 2:207735768-207735790 GAGACAGAATAGCTTGAATCCGG + Intronic
946807731 2:223488187-223488209 AAGAAATAATAGATGGAGTGGGG + Intergenic
948173331 2:235924211-235924233 GATAAAGAATAGATGGAAAGGGG - Intronic
949064330 2:241980439-241980461 GAGACAAAAAAGATGGAAAGCGG + Intergenic
1168870220 20:1121165-1121187 GAGAAAAATTAGATGGACCTTGG - Intronic
1169226521 20:3860360-3860382 AAAAAAAAATAGAAGGAATCAGG - Intronic
1169488250 20:6051468-6051490 GAGAAAAAACAGCTAGAATGGGG - Intronic
1170171493 20:13418288-13418310 GAGAAAATATAAAATGAATCTGG + Intronic
1170698028 20:18677758-18677780 GAGAAAAATAAGAGGGAATTCGG - Intronic
1171095917 20:22332181-22332203 GAGAAAAAAAAGAAGGACTGAGG - Intergenic
1172026667 20:31953367-31953389 GAGAATAAAACGCTGGAATCAGG - Intergenic
1172124044 20:32614571-32614593 GAGGTAAAATAGATGGGCTCTGG - Intergenic
1172439639 20:34956238-34956260 AAAAAAAAATAGATAAAATCAGG - Intergenic
1172879584 20:38190829-38190851 AAGAACAAATTGATGGAAGCTGG - Intergenic
1174194505 20:48763559-48763581 GAAAAAAAATAGTTGGACTGAGG - Intronic
1174643986 20:52070017-52070039 GGTAAACTATAGATGGAATCTGG + Intronic
1175254568 20:57632348-57632370 CAGAAAGAATAGATGGTAGCCGG + Intergenic
1175615853 20:60397719-60397741 GAGAAAAAGCAGAAGCAATCAGG - Intergenic
1177045532 21:16164255-16164277 GAGAAAATATACATGTACTCTGG - Intergenic
1177394891 21:20521033-20521055 CAGAAAAGAAAGATGAAATCAGG - Intergenic
1178021807 21:28416867-28416889 GAGAAAAAATAGAAGGGATAGGG - Intergenic
1178183158 21:30187514-30187536 GAGAAAAAATAGATCATATCTGG - Intergenic
1178617126 21:34144273-34144295 AGGAAAAAACAGATGGCATCAGG - Intergenic
1182244026 22:28940955-28940977 GAGGAAAAAAAAAGGGAATCAGG - Intronic
1182589285 22:31366426-31366448 AAGAAAAAAAAGATAAAATCTGG - Intergenic
1182792658 22:32965992-32966014 GATTAAAAACAGATGGAATCTGG - Intronic
1183131151 22:35837827-35837849 TAGAAGAAATAAATGGAAACTGG - Intronic
1183559634 22:38561351-38561373 AGGAAAAAAGAGATGGAGTCAGG - Intronic
949681193 3:6516397-6516419 GAGTAACAACAGATGGAAACAGG + Intergenic
950067131 3:10121535-10121557 GAAAAAAAAAAGATGGATTCTGG - Intronic
950729234 3:14942427-14942449 CAGAAAAAAAGTATGGAATCTGG - Intergenic
951618347 3:24573173-24573195 GAGAAAAAATACATGGAAGAAGG + Intergenic
951621631 3:24608279-24608301 GAGAAAAACTGGATTCAATCAGG - Intergenic
951934986 3:28012920-28012942 GAGACAAAATATTTGAAATCAGG - Intergenic
952189483 3:31007575-31007597 GTGAAAATTGAGATGGAATCCGG + Intergenic
953075344 3:39564866-39564888 AAGAAAAAATAAATGGAAAAGGG - Intergenic
955470886 3:59284909-59284931 TAGAAAAAATAAATAGAACCTGG + Intergenic
955733894 3:62016521-62016543 GAAACAAAATAGATGGATTGGGG - Intronic
956142257 3:66157603-66157625 AAGAAAAAATAAATGGATTTTGG - Intronic
956258683 3:67312546-67312568 GAAAAAAAAAAGATGGAATTTGG - Intergenic
956332451 3:68126438-68126460 GACCAAAGATAGATGTAATCTGG - Intronic
956369402 3:68542078-68542100 GAGAAAATATAGGTGGAATTAGG + Intronic
956392355 3:68786956-68786978 GAGAAAAAATAAAAAGAGTCAGG + Intronic
956625620 3:71263735-71263757 GAGAAAAAAAAAAAGGAATATGG - Intronic
956963761 3:74434370-74434392 GACAAAAGAGAGATGGAAACAGG - Intronic
957632819 3:82739908-82739930 GTGAAAAAGGAGATAGAATCTGG + Intergenic
957697175 3:83654285-83654307 GAGGAATAATAGATTTAATCAGG + Intergenic
957709927 3:83843020-83843042 GAGAAAGAGTAGCTGGAATGAGG - Intergenic
957872555 3:86108112-86108134 GAGAAAAAATATATGTGCTCTGG - Intergenic
958221782 3:90695520-90695542 TAGAAAAACTAGACGTAATCAGG - Intergenic
958541447 3:95480131-95480153 GAGAAAAGATAGATAGAACAAGG + Intergenic
958731607 3:97966032-97966054 GAGATGGAATAGCTGGAATCAGG + Intronic
959003167 3:100988604-100988626 GAGAAAAAAAGGATCCAATCTGG - Intronic
959344773 3:105179687-105179709 AAGAAAAAATATATTGATTCAGG + Intergenic
959679017 3:109071570-109071592 GAAAAAAAATAGGTGGAGTCTGG + Intronic
960397274 3:117152872-117152894 GAAAAAAAAAAGTTGGAAGCTGG - Intergenic
960893339 3:122475131-122475153 TAGAAATAATACATGGATTCAGG + Intronic
961184039 3:124899180-124899202 GAAAACAAATAAATAGAATCAGG - Intronic
961802134 3:129459516-129459538 AAAAAAAAATAGATGTAGTCAGG - Intronic
961838385 3:129684530-129684552 GAAAAATACTAGATGGATTCTGG + Intronic
961986064 3:131136373-131136395 GAGAAAAATTAGATTGAATGAGG + Intronic
963710888 3:148746378-148746400 AAGAGAAAATAGATTGAAGCAGG + Intergenic
963881822 3:150537017-150537039 TAGAGAAAATATATGGAATTTGG - Intergenic
964635391 3:158852710-158852732 GAGGAAAAATAGAGGAAATTAGG - Intergenic
965050989 3:163647168-163647190 GGGAAAAAAGAGAAGGGATCTGG - Intergenic
965120004 3:164542112-164542134 AAAAAAAAACAGATGGATTCTGG + Intergenic
965260078 3:166471016-166471038 TAGAAAAAATAGTTGAAATTTGG - Intergenic
965297063 3:166961106-166961128 CAGACAAAAAAGATGGAATTTGG - Intergenic
965350432 3:167605487-167605509 GAAAAAAAACAGATGCAGTCTGG + Intronic
965490265 3:169326250-169326272 GAGAAAAGATGGATGCACTCTGG + Intronic
965504265 3:169495110-169495132 GAAAAAAGATGAATGGAATCAGG - Intronic
965686277 3:171306163-171306185 GAGAACACATAGATGGAAAGAGG + Intronic
965751713 3:171981842-171981864 GAAAAATAAAAGATGGAAGCAGG + Intergenic
966126394 3:176581791-176581813 GAGAAACACTAAATGGAAACTGG + Intergenic
966639469 3:182173636-182173658 TAGAAAAAAAAGCTGGATTCTGG + Intergenic
967124409 3:186411414-186411436 GAGAATTAATAGATGTAATGAGG + Intergenic
967146949 3:186614488-186614510 GAGACAAAATATTTGAAATCAGG + Intronic
967391629 3:188961816-188961838 GAGAAAAAAGAAATGGAAGGTGG - Intronic
968355867 3:198106232-198106254 GAGAAAAAATAAAAGGAAGAGGG - Intergenic
969070409 4:4533453-4533475 GAGAAAAATTAAATGAGATCGGG + Intronic
969135247 4:5024022-5024044 TTGAAAATATAGAGGGAATCTGG + Intergenic
969141821 4:5081500-5081522 CAGAAATAATAGATGGACTATGG - Intronic
969788956 4:9478820-9478842 GAGAGAGAAAAGATGGCATCTGG + Intergenic
970847724 4:20562288-20562310 GTGAAAAAATAAAAGGAATGAGG - Intronic
970970792 4:21981089-21981111 GAGAAAAAAGAAACAGAATCAGG - Intergenic
971981412 4:33755988-33756010 GAGAAAAAATATTTTGGATCTGG - Intergenic
972049066 4:34705298-34705320 GAGCAAAACTAAATGGAATTGGG + Intergenic
972307950 4:37850502-37850524 TATAAAAAATATATGGAAGCCGG + Intronic
972480347 4:39490664-39490686 GGGAAGAAAAAGATGGAAGCAGG - Intergenic
972677076 4:41270343-41270365 AAAAAAAAAAAGTTGGAATCAGG - Intergenic
972677782 4:41276850-41276872 AAAAAAAAAAAGTTGGAATCGGG - Intergenic
972883447 4:43455056-43455078 GAGACAACATAGATGGAACTGGG + Intergenic
972967718 4:44532314-44532336 GAGAAAAAATTTATAGAATAAGG - Intergenic
973193253 4:47410682-47410704 AAGAAAAAATAGCTAGAAGCTGG + Intronic
973227883 4:47806939-47806961 GAGCACAGATACATGGAATCAGG + Exonic
974118105 4:57605804-57605826 CAGAAAAAATATATGGCATGAGG - Intergenic
974250548 4:59378118-59378140 GAGAGAAAAGAGATGGAGTTTGG + Intergenic
974522832 4:63007541-63007563 AAAAAAAAATAGATGGTAGCTGG - Intergenic
976034738 4:80803126-80803148 GAAAAAACATAAATGGAATTTGG - Intronic
976967058 4:91056354-91056376 AAGAACAAATAGCTGGCATCTGG + Intronic
977206901 4:94173504-94173526 GAAAAAAAAAAGAAGGAAGCAGG + Intergenic
977693157 4:99938275-99938297 AAAAAAAAAAAGATGGTATCTGG + Intronic
978974459 4:114852334-114852356 CAGATAAAATAGTTTGAATCGGG + Intronic
979561394 4:122105946-122105968 GAGATAAAAGAGATAAAATCAGG + Intergenic
979694513 4:123597440-123597462 GACAAAAAGTAGATGGAGTTGGG - Intergenic
979699259 4:123649222-123649244 GAAAATAAATATATGGAAGCAGG - Intergenic
979801501 4:124914699-124914721 AAAAAAAAATAAATGGCATCAGG + Intergenic
979862346 4:125709059-125709081 GAAAAAAAATAAATGGAAGGGGG - Intergenic
980160975 4:129162565-129162587 GTGAAAAAGTAGATGAAATATGG - Intergenic
980597997 4:134980875-134980897 GAGAAAAAGAAGAAGTAATCAGG - Intergenic
980773084 4:137404289-137404311 AAAAAAAAAAAGATGGAATTGGG - Intergenic
980805040 4:137801692-137801714 GAGAGCAAATAAATAGAATCTGG - Intergenic
982050730 4:151498822-151498844 GAAAAAAAATATATGAAATATGG + Intronic
982247298 4:153365806-153365828 GTGAAAAAATTGTTGGATTCTGG + Intronic
982828206 4:160026996-160027018 GAGTGAAAATAGATGGTAGCTGG - Intergenic
983411624 4:167405707-167405729 TAGATAAAATATTTGGAATCTGG + Intergenic
984105567 4:175541271-175541293 GAGGAAAAGTAGATGGATGCTGG - Intergenic
984219732 4:176958589-176958611 AAGAAAAAATATATGGAACTTGG - Intergenic
984727167 4:183032656-183032678 TAGAAAAAAGAGAAGGCATCAGG + Intergenic
985115515 4:186586247-186586269 GAGAACAAAAAAATGGAGTCTGG + Intergenic
985139656 4:186826773-186826795 GAAAAAAAATTAATAGAATCTGG + Intergenic
985925568 5:3013683-3013705 GAGCAAATAAAGATGGAATAAGG - Intergenic
986202776 5:5593023-5593045 GAGGAAAAAAAGAAGGAAGCTGG - Intergenic
987356705 5:17069677-17069699 GAGGAAAATAAGATGGATTCAGG + Intronic
987835134 5:23150874-23150896 GAGAGTAAATAGCTGGAATAGGG - Intergenic
988139331 5:27215796-27215818 AAGAAAAAGTAGATAGGATCAGG + Intergenic
988253193 5:28787153-28787175 GAGAGAAAATAGATAAAATGAGG + Intergenic
988314511 5:29606093-29606115 TAGAAGAAATAAATGGACTCAGG + Intergenic
988344129 5:30014756-30014778 GAGAAAAAATAGGAGGAAGAGGG - Intergenic
988672500 5:33397024-33397046 AAGAAAAAAAAAATGGAATTTGG - Intergenic
990020025 5:51114821-51114843 GAAAAAAAATAGATGAAATGGGG - Intergenic
990355265 5:54960629-54960651 GAGAAACCATAGCTGGAATTTGG + Intergenic
991438588 5:66622091-66622113 GAGAAAAAAAAAATGGAATATGG + Intronic
992430492 5:76706225-76706247 GAGAAAAAATAAATAGAAATAGG + Intronic
992568182 5:78023465-78023487 AAGAAAAAAGAAAGGGAATCAGG + Intronic
992632727 5:78697612-78697634 GAGAAAAAATGGAAGGCAGCAGG - Intronic
992730715 5:79665441-79665463 CAGAAAAAAATGATGGAATCTGG + Intronic
992752253 5:79872240-79872262 GAGAACACACAGATGGACTCTGG + Intergenic
992927859 5:81609002-81609024 AAGAGAAAATAGAAGGAATTTGG + Intronic
993202334 5:84831513-84831535 GAGAAAAAATAAAAGGAAGAGGG + Intergenic
993408299 5:87540817-87540839 GAGAAAATTTAAATGGAATGAGG - Intergenic
993728785 5:91398178-91398200 AAGTAAAGAGAGATGGAATCTGG + Intergenic
994008210 5:94866535-94866557 AAAAAAAAAAAGAGGGAATCAGG - Intronic
994870551 5:105343925-105343947 AAGAAAAAATACATTGAAGCTGG + Intergenic
995469256 5:112483299-112483321 GAGCAAAAATAGATGAAACCTGG - Intergenic
995518265 5:112975682-112975704 GGGAAAAAAAAGATGGAAAACGG + Intergenic
996019027 5:118571739-118571761 GACAAAAAATAAATTGAATGTGG - Intergenic
996040276 5:118801427-118801449 GGGAAAATATAGATGGATTTGGG - Intergenic
997229471 5:132232159-132232181 GAGAAAAAAGTGAGGGAACCTGG - Intronic
997621044 5:135295621-135295643 GAGAAAATACAGAAGGAACCTGG - Intronic
998244939 5:140491656-140491678 GTGAGAAAATAGAGGCAATCAGG - Intronic
998450590 5:142231654-142231676 GAGAAAGAATAGACTGGATCTGG - Intergenic
999299491 5:150482347-150482369 CAGAAAGAATGGATGGGATCAGG - Intergenic
999464125 5:151785411-151785433 TAGACAAAATAGATTGACTCTGG - Intronic
999717545 5:154373555-154373577 GAGATAATATAGATGAAATAGGG + Intronic
999798724 5:155012790-155012812 GAGAAAACCTAGATGAATTCAGG - Intergenic
1000235745 5:159358640-159358662 GAGAAACAGAAGATGGAAACAGG - Intergenic
1001783910 5:174395195-174395217 AAGAAAAAATAGATAGTAACAGG + Intergenic
1004810621 6:19257269-19257291 GAGAAAAGATGGAGAGAATCTGG - Intergenic
1005478815 6:26235123-26235145 GAGTAAAAATATAAGAAATCTGG + Intergenic
1008827479 6:55714858-55714880 AAAGAAAAATAGATAGAATCAGG + Intergenic
1008898191 6:56581544-56581566 GAGGAAAAAAAGGTGGAAGCAGG + Intronic
1009287439 6:61838676-61838698 GGGTCAAAATAGATGGATTCAGG - Intronic
1009294327 6:61926145-61926167 GAGAAAACGTAGGTAGAATCTGG + Intronic
1009575938 6:65460141-65460163 GAGAAAAAATAAAAGGAAAGAGG + Intronic
1010017895 6:71125469-71125491 GAGAAAAGAAAAATGGAATCAGG - Intergenic
1010046941 6:71456200-71456222 AAGAAACAATAGAATGAATCAGG - Intergenic
1010791121 6:80066273-80066295 GAAAAAAATAAGATGGAACCAGG - Intergenic
1010996312 6:82537616-82537638 GAGAGAAAAATGATGGAATGTGG - Intergenic
1012123787 6:95400444-95400466 GAAAAAAAATAGATGTAAATAGG - Intergenic
1012736170 6:102947748-102947770 GAGAGAAAATCTATGGATTCTGG + Intergenic
1012854080 6:104480561-104480583 AAGAAGAAATAGATGGGGTCGGG + Intergenic
1013329615 6:109086831-109086853 GGAATAAAATAGATGAAATCAGG + Intronic
1014156950 6:118122205-118122227 GAGAAAAAAATGAAGGAATTGGG - Intronic
1014806459 6:125835384-125835406 GAGAAAAAAAAAAAGGAATATGG + Intronic
1015196773 6:130532224-130532246 TTGAAAAAATAGATGGAGTTAGG - Intergenic
1015213231 6:130721271-130721293 GAGAAAAAATGGGTGGAAGTTGG + Intergenic
1015262675 6:131256383-131256405 ATGAATTAATAGATGGAATCAGG - Intronic
1016097088 6:140051451-140051473 GTAAAGAAATTGATGGAATCAGG + Intergenic
1016471550 6:144379923-144379945 GAGAAGGAAGAAATGGAATCTGG + Intronic
1016574713 6:145556030-145556052 GAGAAAAAAATAATGGAATCTGG - Intronic
1016639673 6:146334338-146334360 GAGAAAAACTATATGACATCAGG + Intronic
1016702857 6:147073057-147073079 GGGAAAAAAGAGATGGAGACGGG + Intergenic
1016935392 6:149445870-149445892 GAGAATAAACAGAAGGAAACAGG + Intergenic
1018102079 6:160449347-160449369 GAAAAAAATTAGAAAGAATCTGG - Intronic
1018229431 6:161661546-161661568 GAAAAAAAAAAAATGGAAGCAGG - Intronic
1020558428 7:9698509-9698531 GAGAAAAGAAAAAGGGAATCAGG - Intergenic
1021075055 7:16292920-16292942 GACAGAAAATGGATGTAATCAGG + Intronic
1021179359 7:17487990-17488012 AAGAAAGAGAAGATGGAATCTGG + Intergenic
1021218609 7:17948215-17948237 GAAGAAAAATAGATGAGATCTGG + Intergenic
1021294575 7:18888654-18888676 GAGAAATAATAGTTTTAATCTGG - Intronic
1022702557 7:32775495-32775517 GAGAAACAGTATATAGAATCTGG - Intergenic
1023291652 7:38674381-38674403 AAGAAACAACAGAAGGAATCTGG - Intergenic
1023343154 7:39243788-39243810 GAGACAAATCAGATGGATTCTGG - Intronic
1023719908 7:43082179-43082201 AGGAAAAAGTAGATAGAATCAGG + Intergenic
1023741714 7:43287172-43287194 GAGAAATAATACAGGGAATAGGG + Intronic
1027873449 7:83739570-83739592 GAGATAAAATAGAGGAAATGAGG + Intergenic
1028359783 7:89953837-89953859 AAAAAAAAATAAAAGGAATCAGG - Intergenic
1029898014 7:104006920-104006942 GAGAAAAAATACCTATAATCTGG - Intergenic
1030238724 7:107295517-107295539 AAGAGAAAATGAATGGAATCAGG - Intronic
1030723787 7:112900952-112900974 GAGAAAACCTAGATGGCATTGGG + Intronic
1031253260 7:119414207-119414229 GAGAAAACAAAAATGAAATCAGG + Intergenic
1031679303 7:124651597-124651619 GAAAGAAAAAAGATGTAATCGGG + Intergenic
1031820733 7:126498040-126498062 GAGAAGAAAAGGATGGATTCTGG + Intronic
1032373424 7:131383768-131383790 GAGAAACAATTGATGGGATTTGG - Intronic
1032748086 7:134808092-134808114 AAAAAAAAAAAGATGGAATGGGG - Intronic
1032888893 7:136172015-136172037 AAGAAAAAATAGAGGGAACTAGG - Intergenic
1034032636 7:147785200-147785222 GAGAGAAAATAGAATGAAACAGG + Intronic
1035835339 8:2744558-2744580 TTGAAAAAAAAGATGGAATGTGG + Intergenic
1039398953 8:37252336-37252358 GAGAAAAAATATATTGGATTTGG + Intergenic
1039646395 8:39289277-39289299 GAGAAAAATTAAATGAAATTTGG - Intergenic
1039654201 8:39381381-39381403 GAGAGAAAATAGTTGAAATTTGG + Intergenic
1040764799 8:50894543-50894565 GAGAAAAAATATTTGTTATCTGG - Intergenic
1041461634 8:58118170-58118192 GAGAAGAAATATATTGAATTGGG - Intronic
1041916753 8:63146261-63146283 GAGGAAAAAGAGGTGGAATCAGG + Intergenic
1042173311 8:66013931-66013953 GAGAAAAAATAGATGCTCTATGG - Intergenic
1043089424 8:75878692-75878714 GAGAGAAAAAATAGGGAATCTGG - Intergenic
1043692895 8:83179676-83179698 GAGAAGAAATACATAGAGTCTGG + Intergenic
1043919618 8:85965980-85966002 GTTAAAGAAAAGATGGAATCAGG + Intergenic
1043920618 8:85979400-85979422 TAGAAAAAAATGATGGAATAAGG - Intergenic
1044024302 8:87149749-87149771 GAAAAAAAATAGTTTAAATCAGG + Intronic
1044881481 8:96727629-96727651 GAGAAAAAAAATCCGGAATCTGG - Intronic
1045279994 8:100741900-100741922 GAGAAAAATTAGAGTGAATGGGG + Intergenic
1045406377 8:101870808-101870830 GAGAAAATAAAGAGGGAATGAGG + Intronic
1045526465 8:102944739-102944761 GAAAAAAAAGAGATGGAAGCAGG + Intronic
1045982084 8:108201603-108201625 GTGAAAAAATTGAGGGAAACAGG + Intronic
1046185151 8:110704104-110704126 CAGAAAAAATAGTTTTAATCAGG + Intergenic
1046766458 8:118074835-118074857 GAGAAAAAAAAGATGGATGAGGG + Intronic
1047350407 8:124068082-124068104 GAATAAAAATAGAAGCAATCTGG + Intronic
1048605758 8:135967150-135967172 CAGAAAGAATAGATGGTACCTGG - Intergenic
1048790538 8:138099434-138099456 GAGATAAAAAAGATGGATTTGGG - Intergenic
1050213842 9:3298451-3298473 AAGAAACAATAGAAGGGATCAGG - Intronic
1050516631 9:6451426-6451448 GAAACAAGATAGAAGGAATCAGG - Intronic
1051461371 9:17320379-17320401 AAAAAAAGAAAGATGGAATCAGG - Intronic
1051937922 9:22466854-22466876 GAGAAAGTATAGATAGAGTCAGG + Intergenic
1052607530 9:30723624-30723646 GAGAAAACATAGGTGGTAGCCGG + Intergenic
1053507673 9:38657679-38657701 TAGAAAAACTAGATGTAAACTGG - Intergenic
1054921763 9:70550387-70550409 CCTAAAAAATAGAAGGAATCTGG + Intronic
1055117976 9:72625700-72625722 AAGAAAAAAAAAAAGGAATCAGG + Intronic
1055789045 9:79901623-79901645 GAGAAAGAAGAGATGGGGTCTGG + Intergenic
1055868966 9:80851153-80851175 GAGGAAAGATACATGCAATCTGG + Intergenic
1055885000 9:81051598-81051620 GTTAAAAAAAAAATGGAATCAGG + Intergenic
1057958797 9:99434810-99434832 GAGTTGGAATAGATGGAATCTGG + Intergenic
1058014314 9:100013316-100013338 GAGTAATAATGGATGTAATCTGG + Intronic
1058360551 9:104141825-104141847 GAGAACTAAAAGATGGGATCTGG + Intergenic
1058482779 9:105413993-105414015 AAAAAAAAATAGATGGACTCAGG + Intronic
1059811019 9:117855703-117855725 TAGAAGAAAGAGATGGAAGCTGG + Intergenic
1186839585 X:13471621-13471643 GAGAAAAAAGAGAGGGAAACAGG + Intergenic
1186846884 X:13539749-13539771 TAAAAAACACAGATGGAATCTGG - Intergenic
1187296328 X:18004601-18004623 AAGAAAAAGTAGAGAGAATCAGG + Intergenic
1187319066 X:18224220-18224242 GAGGAACAAAAGTTGGAATCTGG + Intergenic
1188118907 X:26280559-26280581 GTGAAAAAATATATGTAATGAGG - Intergenic
1189021878 X:37349617-37349639 GAAAAAAAATTGAAGGAATGGGG + Intronic
1189537955 X:41955969-41955991 GAGAAGAAGTAGCTGGATTCTGG - Intergenic
1189553163 X:42114094-42114116 GAGAGAAAATTTAGGGAATCTGG - Intergenic
1190106424 X:47564275-47564297 AGGACAAAATAGATGAAATCTGG - Intronic
1190460243 X:50666071-50666093 CAGGGAAAATAGATGGGATCTGG + Intronic
1191633400 X:63350260-63350282 GGGAAATAGTAGTTGGAATCTGG + Exonic
1192489287 X:71560293-71560315 AAGAAAAAATAGATGAACTATGG + Intronic
1192586790 X:72325543-72325565 GATAAATGATAGATGGTATCTGG + Intergenic
1192746668 X:73945734-73945756 GAGAAGAGAGAGATGCAATCAGG - Intergenic
1192817379 X:74608671-74608693 GAGAAAAACTAAAAGGACTCAGG + Intronic
1193849765 X:86522611-86522633 GAGAAAGGCTAGGTGGAATCTGG - Intronic
1193988090 X:88271465-88271487 GAGAAATAATATATGTATTCAGG + Intergenic
1194064542 X:89245435-89245457 GAGAAAATATAGATGGCCTTTGG - Intergenic
1194888798 X:99352575-99352597 GAGAAAAAATATAAGCAAGCTGG - Intergenic
1195722910 X:107883840-107883862 TAGAAAATATATTTGGAATCTGG + Intronic
1195879544 X:109578097-109578119 GAGAACAAATAGGTGGAAAAAGG - Intergenic
1196832889 X:119790210-119790232 CAGATAAAATAAGTGGAATCCGG + Intronic
1197046749 X:122006682-122006704 GAGGTCAAATAGATGGCATCTGG + Intergenic
1198619179 X:138487893-138487915 GAGAAGAGCTGGATGGAATCTGG - Intergenic
1200718713 Y:6579517-6579539 GAGAAAATATAGATGGCCTTTGG - Intergenic
1202099300 Y:21288906-21288928 GTGAAAAAATGCATGGAATTTGG + Intergenic