ID: 928305351

View in Genome Browser
Species Human (GRCh38)
Location 2:30165706-30165728
Sequence GGAAAATTCTTTGCAGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928305351_928305355 27 Left 928305351 2:30165706-30165728 CCAGTTGCTGCAAAGAATTTTCC No data
Right 928305355 2:30165756-30165778 GAGTGCCTGTTATGTGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928305351 Original CRISPR GGAAAATTCTTTGCAGCAAC TGG (reversed) Intergenic
No off target data available for this crispr