ID: 928305507

View in Genome Browser
Species Human (GRCh38)
Location 2:30167094-30167116
Sequence TGCCATAACCAGACTTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928305496_928305507 25 Left 928305496 2:30167046-30167068 CCCTTTTAGATGCCTGATTTCCA No data
Right 928305507 2:30167094-30167116 TGCCATAACCAGACTTGGGAAGG No data
928305499_928305507 5 Left 928305499 2:30167066-30167088 CCAAGCCTGACCATCTAAGCCCC No data
Right 928305507 2:30167094-30167116 TGCCATAACCAGACTTGGGAAGG No data
928305500_928305507 0 Left 928305500 2:30167071-30167093 CCTGACCATCTAAGCCCCACATC No data
Right 928305507 2:30167094-30167116 TGCCATAACCAGACTTGGGAAGG No data
928305501_928305507 -5 Left 928305501 2:30167076-30167098 CCATCTAAGCCCCACATCTGCCA No data
Right 928305507 2:30167094-30167116 TGCCATAACCAGACTTGGGAAGG No data
928305498_928305507 13 Left 928305498 2:30167058-30167080 CCTGATTTCCAAGCCTGACCATC No data
Right 928305507 2:30167094-30167116 TGCCATAACCAGACTTGGGAAGG No data
928305497_928305507 24 Left 928305497 2:30167047-30167069 CCTTTTAGATGCCTGATTTCCAA No data
Right 928305507 2:30167094-30167116 TGCCATAACCAGACTTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928305507 Original CRISPR TGCCATAACCAGACTTGGGA AGG Intergenic
No off target data available for this crispr