ID: 928306853

View in Genome Browser
Species Human (GRCh38)
Location 2:30177423-30177445
Sequence GGCCACCATAATAACCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928306853_928306856 6 Left 928306853 2:30177423-30177445 CCTTCAGGGTTATTATGGTGGCC No data
Right 928306856 2:30177452-30177474 CTTTGTTGTCCCCTCAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928306853 Original CRISPR GGCCACCATAATAACCCTGA AGG (reversed) Intergenic
No off target data available for this crispr