ID: 928310399

View in Genome Browser
Species Human (GRCh38)
Location 2:30204923-30204945
Sequence AGGGAAAAGCAACATGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928310399_928310411 25 Left 928310399 2:30204923-30204945 CCAGGCACATGTTGCTTTTCCCT No data
Right 928310411 2:30204971-30204993 TCCCCATGCCCATCAGCCATGGG No data
928310399_928310404 -9 Left 928310399 2:30204923-30204945 CCAGGCACATGTTGCTTTTCCCT No data
Right 928310404 2:30204937-30204959 CTTTTCCCTGGGAGTAGGGCTGG No data
928310399_928310405 -8 Left 928310399 2:30204923-30204945 CCAGGCACATGTTGCTTTTCCCT No data
Right 928310405 2:30204938-30204960 TTTTCCCTGGGAGTAGGGCTGGG No data
928310399_928310413 26 Left 928310399 2:30204923-30204945 CCAGGCACATGTTGCTTTTCCCT No data
Right 928310413 2:30204972-30204994 CCCCATGCCCATCAGCCATGGGG No data
928310399_928310410 24 Left 928310399 2:30204923-30204945 CCAGGCACATGTTGCTTTTCCCT No data
Right 928310410 2:30204970-30204992 CTCCCCATGCCCATCAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928310399 Original CRISPR AGGGAAAAGCAACATGTGCC TGG (reversed) Intergenic
No off target data available for this crispr