ID: 928311912

View in Genome Browser
Species Human (GRCh38)
Location 2:30218241-30218263
Sequence GAACCCTTGATTTAAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928311912_928311916 8 Left 928311912 2:30218241-30218263 CCTGTCCCTTAAATCAAGGGTTC No data
Right 928311916 2:30218272-30218294 TAGTGCGTTACTAGGTCACCTGG No data
928311912_928311920 29 Left 928311912 2:30218241-30218263 CCTGTCCCTTAAATCAAGGGTTC No data
Right 928311920 2:30218293-30218315 GGGGAATGCCATTAAAATGCAGG No data
928311912_928311915 0 Left 928311912 2:30218241-30218263 CCTGTCCCTTAAATCAAGGGTTC No data
Right 928311915 2:30218264-30218286 TCAAACTGTAGTGCGTTACTAGG No data
928311912_928311918 10 Left 928311912 2:30218241-30218263 CCTGTCCCTTAAATCAAGGGTTC No data
Right 928311918 2:30218274-30218296 GTGCGTTACTAGGTCACCTGGGG No data
928311912_928311917 9 Left 928311912 2:30218241-30218263 CCTGTCCCTTAAATCAAGGGTTC No data
Right 928311917 2:30218273-30218295 AGTGCGTTACTAGGTCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928311912 Original CRISPR GAACCCTTGATTTAAGGGAC AGG (reversed) Intergenic
No off target data available for this crispr