ID: 928312102

View in Genome Browser
Species Human (GRCh38)
Location 2:30219794-30219816
Sequence GCTTCTCTGCAGCAGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928312102_928312105 9 Left 928312102 2:30219794-30219816 CCAGGCAGCTGCTGCAGAGAAGC No data
Right 928312105 2:30219826-30219848 CCTGATGCTGAGGCTCCCCATGG No data
928312102_928312111 30 Left 928312102 2:30219794-30219816 CCAGGCAGCTGCTGCAGAGAAGC No data
Right 928312111 2:30219847-30219869 GGGGCCTCATGAGAAAGAATTGG No data
928312102_928312107 11 Left 928312102 2:30219794-30219816 CCAGGCAGCTGCTGCAGAGAAGC No data
Right 928312107 2:30219828-30219850 TGATGCTGAGGCTCCCCATGGGG No data
928312102_928312103 -1 Left 928312102 2:30219794-30219816 CCAGGCAGCTGCTGCAGAGAAGC No data
Right 928312103 2:30219816-30219838 CACATCTATTCCTGATGCTGAGG No data
928312102_928312106 10 Left 928312102 2:30219794-30219816 CCAGGCAGCTGCTGCAGAGAAGC No data
Right 928312106 2:30219827-30219849 CTGATGCTGAGGCTCCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928312102 Original CRISPR GCTTCTCTGCAGCAGCTGCC TGG (reversed) Intergenic
No off target data available for this crispr