ID: 928312123

View in Genome Browser
Species Human (GRCh38)
Location 2:30219912-30219934
Sequence AACTCCCTATGGTGTATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928312123_928312131 3 Left 928312123 2:30219912-30219934 CCTACCATACACCATAGGGAGTT No data
Right 928312131 2:30219938-30219960 TGGGATGGAGTTTCCTGGGATGG No data
928312123_928312129 -2 Left 928312123 2:30219912-30219934 CCTACCATACACCATAGGGAGTT No data
Right 928312129 2:30219933-30219955 TTTTCTGGGATGGAGTTTCCTGG No data
928312123_928312133 26 Left 928312123 2:30219912-30219934 CCTACCATACACCATAGGGAGTT No data
Right 928312133 2:30219961-30219983 TTCCTATGACATCCCAGTGCAGG No data
928312123_928312130 -1 Left 928312123 2:30219912-30219934 CCTACCATACACCATAGGGAGTT No data
Right 928312130 2:30219934-30219956 TTTCTGGGATGGAGTTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928312123 Original CRISPR AACTCCCTATGGTGTATGGT AGG (reversed) Intergenic
No off target data available for this crispr