ID: 928312299

View in Genome Browser
Species Human (GRCh38)
Location 2:30221025-30221047
Sequence TGGTTGTTTCTCTAGCTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928312299_928312304 4 Left 928312299 2:30221025-30221047 CCCAAGAGCTAGAGAAACAACCA No data
Right 928312304 2:30221052-30221074 GGATGGTCTGACAGCACCGCTGG No data
928312299_928312306 24 Left 928312299 2:30221025-30221047 CCCAAGAGCTAGAGAAACAACCA No data
Right 928312306 2:30221072-30221094 TGGCCACAGCTGCTACTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928312299 Original CRISPR TGGTTGTTTCTCTAGCTCTT GGG (reversed) Intergenic
No off target data available for this crispr