ID: 928312300

View in Genome Browser
Species Human (GRCh38)
Location 2:30221026-30221048
Sequence CTGGTTGTTTCTCTAGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928312300_928312306 23 Left 928312300 2:30221026-30221048 CCAAGAGCTAGAGAAACAACCAG No data
Right 928312306 2:30221072-30221094 TGGCCACAGCTGCTACTCAGTGG No data
928312300_928312304 3 Left 928312300 2:30221026-30221048 CCAAGAGCTAGAGAAACAACCAG No data
Right 928312304 2:30221052-30221074 GGATGGTCTGACAGCACCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928312300 Original CRISPR CTGGTTGTTTCTCTAGCTCT TGG (reversed) Intergenic
No off target data available for this crispr