ID: 928312303

View in Genome Browser
Species Human (GRCh38)
Location 2:30221045-30221067
Sequence TGCTGTCAGACCATCCACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928312303_928312308 19 Left 928312303 2:30221045-30221067 CCAGCGTGGATGGTCTGACAGCA No data
Right 928312308 2:30221087-30221109 CTCAGTGGCCGTTCATCACATGG No data
928312303_928312306 4 Left 928312303 2:30221045-30221067 CCAGCGTGGATGGTCTGACAGCA No data
Right 928312306 2:30221072-30221094 TGGCCACAGCTGCTACTCAGTGG No data
928312303_928312310 26 Left 928312303 2:30221045-30221067 CCAGCGTGGATGGTCTGACAGCA No data
Right 928312310 2:30221094-30221116 GCCGTTCATCACATGGAAAAGGG No data
928312303_928312309 25 Left 928312303 2:30221045-30221067 CCAGCGTGGATGGTCTGACAGCA No data
Right 928312309 2:30221093-30221115 GGCCGTTCATCACATGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928312303 Original CRISPR TGCTGTCAGACCATCCACGC TGG (reversed) Intergenic
No off target data available for this crispr