ID: 928312306

View in Genome Browser
Species Human (GRCh38)
Location 2:30221072-30221094
Sequence TGGCCACAGCTGCTACTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928312300_928312306 23 Left 928312300 2:30221026-30221048 CCAAGAGCTAGAGAAACAACCAG No data
Right 928312306 2:30221072-30221094 TGGCCACAGCTGCTACTCAGTGG No data
928312303_928312306 4 Left 928312303 2:30221045-30221067 CCAGCGTGGATGGTCTGACAGCA No data
Right 928312306 2:30221072-30221094 TGGCCACAGCTGCTACTCAGTGG No data
928312299_928312306 24 Left 928312299 2:30221025-30221047 CCCAAGAGCTAGAGAAACAACCA No data
Right 928312306 2:30221072-30221094 TGGCCACAGCTGCTACTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928312306 Original CRISPR TGGCCACAGCTGCTACTCAG TGG Intergenic
No off target data available for this crispr