ID: 928312403

View in Genome Browser
Species Human (GRCh38)
Location 2:30221781-30221803
Sequence CCTTCTGTACACAGGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928312403_928312412 -5 Left 928312403 2:30221781-30221803 CCCGCTTCCCTGTGTACAGAAGG No data
Right 928312412 2:30221799-30221821 GAAGGCAGGCTGCGAAGGTGGGG No data
928312403_928312411 -6 Left 928312403 2:30221781-30221803 CCCGCTTCCCTGTGTACAGAAGG No data
Right 928312411 2:30221798-30221820 AGAAGGCAGGCTGCGAAGGTGGG No data
928312403_928312409 -10 Left 928312403 2:30221781-30221803 CCCGCTTCCCTGTGTACAGAAGG No data
Right 928312409 2:30221794-30221816 GTACAGAAGGCAGGCTGCGAAGG No data
928312403_928312410 -7 Left 928312403 2:30221781-30221803 CCCGCTTCCCTGTGTACAGAAGG No data
Right 928312410 2:30221797-30221819 CAGAAGGCAGGCTGCGAAGGTGG No data
928312403_928312414 20 Left 928312403 2:30221781-30221803 CCCGCTTCCCTGTGTACAGAAGG No data
Right 928312414 2:30221824-30221846 CCATACATTCTAGTCCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928312403 Original CRISPR CCTTCTGTACACAGGGAAGC GGG (reversed) Intergenic
No off target data available for this crispr