ID: 928312579

View in Genome Browser
Species Human (GRCh38)
Location 2:30222956-30222978
Sequence ACATTTCCACACGCTTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928312579_928312583 25 Left 928312579 2:30222956-30222978 CCTCACCAAGCGTGTGGAAATGT No data
Right 928312583 2:30223004-30223026 GCTTTTGCTCAGACTCACACAGG No data
928312579_928312581 3 Left 928312579 2:30222956-30222978 CCTCACCAAGCGTGTGGAAATGT No data
Right 928312581 2:30222982-30223004 TCTGCTGTCATTACTTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928312579 Original CRISPR ACATTTCCACACGCTTGGTG AGG (reversed) Intergenic
No off target data available for this crispr