ID: 928314060

View in Genome Browser
Species Human (GRCh38)
Location 2:30232394-30232416
Sequence GTGCTGAAGGGGAAGGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 0, 2: 2, 3: 75, 4: 620}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928314046_928314060 24 Left 928314046 2:30232347-30232369 CCGACGCACATTGGTGGGGGCCG 0: 1
1: 0
2: 0
3: 12
4: 122
Right 928314060 2:30232394-30232416 GTGCTGAAGGGGAAGGAGCCCGG 0: 1
1: 0
2: 2
3: 75
4: 620
928314052_928314060 4 Left 928314052 2:30232367-30232389 CCGGGACTGGGAGGAGCCGCCTT 0: 1
1: 0
2: 0
3: 11
4: 218
Right 928314060 2:30232394-30232416 GTGCTGAAGGGGAAGGAGCCCGG 0: 1
1: 0
2: 2
3: 75
4: 620

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928314060 Original CRISPR GTGCTGAAGGGGAAGGAGCC CGG Intronic
900138994 1:1131381-1131403 GCGCTGGAAGGGACGGAGCCAGG - Intergenic
900204814 1:1427356-1427378 GTGATGGAGGGGAAGGGGCAGGG - Intronic
900284963 1:1894632-1894654 GGGCTGAAGGGAATGGAGGCGGG - Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901038561 1:6350603-6350625 GTGCTGTCTGGGAAGGTGCCAGG - Intronic
901598534 1:10404216-10404238 GTGGTGGAGAGGAAGGGGCCCGG + Exonic
901715837 1:11153181-11153203 GAGTGGAAGGGGAAGGGGCCAGG + Intronic
901791496 1:11655548-11655570 GGGCAGAGGGGGAAGAAGCCCGG - Exonic
903227885 1:21904156-21904178 GTGCTGAAGGGGAAGGAAGGGGG + Intronic
903240720 1:21980975-21980997 GTGATGATGGGGAAGGAGGGAGG + Intronic
903244460 1:22005598-22005620 GTGATGATGGGGAAGGAGGGAGG + Intronic
903927352 1:26840070-26840092 GTGCTGGAGAGAAAGAAGCCTGG + Intronic
904260131 1:29283370-29283392 GTGCTCTGTGGGAAGGAGCCTGG - Intronic
904265173 1:29314449-29314471 GAGCTGAGGGGGAAGGAGAGTGG - Intronic
904419812 1:30384366-30384388 GTGGGGAGGGGGAAGGTGCCAGG + Intergenic
904474779 1:30757770-30757792 ACACTGAAGGGGAAAGAGCCTGG + Exonic
904479504 1:30785207-30785229 TTCCTGAGGGGGAAGGATCCAGG - Intergenic
905797457 1:40823671-40823693 GTGCTGGAGGGGAAGGAAGCTGG + Intronic
906306598 1:44723925-44723947 GGGCTGAAGGGGGAGGAGGAAGG - Intronic
906922076 1:50075469-50075491 GTACTGAAGAGGAAGGAGAAGGG + Intronic
907216086 1:52865234-52865256 GTGTTGTGGGGGAGGGAGCCAGG - Intronic
907294272 1:53439581-53439603 GTGCTGGAGGGGAAGGGGCGGGG - Intergenic
907760475 1:57353746-57353768 GTGTGGAAGGGGGAGGAGCAGGG - Intronic
908407402 1:63828836-63828858 GTGCTGAAGCAGGAGTAGCCTGG - Intronic
909298318 1:73979922-73979944 GTACTGAATGAGAAGGAACCTGG - Intergenic
910031843 1:82735361-82735383 AGGCTGAGGAGGAAGGAGCCTGG + Intergenic
910207221 1:84759892-84759914 GTGCAGAAGGGAGAGGAGCGGGG + Intergenic
910378244 1:86596575-86596597 TGGCTGAAGGGGAAGGAGGGAGG - Intergenic
910538157 1:88323581-88323603 CGGCCGAAGGGGAAGGAGACAGG + Intergenic
910757221 1:90706588-90706610 GTCCTGAAGGTGGAGGAGCGCGG + Intergenic
911784768 1:101932462-101932484 GGGCTGAAGGGGGAGGAAGCTGG + Intronic
911921452 1:103766716-103766738 GTGCTGGAGGACAGGGAGCCTGG - Intergenic
912800752 1:112718682-112718704 GTGCTGGGGGGAAAGGAGCTGGG - Intergenic
912879010 1:113390633-113390655 GAGGTGAAGGGGGAAGAGCCGGG - Intergenic
914048861 1:144114786-144114808 GTCCTGAAGAGGCAGGAACCAGG - Intergenic
914130323 1:144850662-144850684 GTCCTGAAGAGGCAGGAACCAGG + Intergenic
914417583 1:147498204-147498226 TTGCTGAAGGGGAAAGGGCAGGG - Intergenic
915367786 1:155325170-155325192 GTGCAGAAGGTGAAGGTGGCTGG + Exonic
916181629 1:162088960-162088982 GAGATGAAGGGGAAGGAGAATGG - Intronic
916470299 1:165117252-165117274 GTGCTCAAGGGAAATGAGCCTGG - Intergenic
916579385 1:166094081-166094103 GTGCAGCAGGGGAAGGAAGCAGG + Intronic
917815171 1:178702263-178702285 GTGGTGGAGGGGAGGGAGACAGG - Intergenic
917959112 1:180128484-180128506 GTGCAGCATGGGAGGGAGCCCGG + Intergenic
917968955 1:180195209-180195231 CTGCTGGAGGGCCAGGAGCCTGG + Intronic
917979035 1:180258209-180258231 GTGCTGAGGGGGAGGGGTCCAGG + Intronic
920081168 1:203373803-203373825 GTGGTGAAGAGGAAGGAGAGTGG - Intergenic
920309870 1:205042873-205042895 GGGCTGAAGGGGCAGGAGAGGGG - Intergenic
920365615 1:205446842-205446864 GGGCAGGAGGGGAAGTAGCCTGG + Intronic
920703649 1:208236148-208236170 CTGTGGACGGGGAAGGAGCCTGG + Intronic
921080861 1:211737499-211737521 ATGAGGAATGGGAAGGAGCCAGG - Intergenic
921104072 1:211958958-211958980 GGGCTGAAGGGGAGGAAGCTGGG + Intronic
921800851 1:219400140-219400162 GGGCTGAAGGGGAAGGAAGCTGG - Intergenic
921924912 1:220703408-220703430 GGGCTGAAGAGGATGGAGCTGGG + Intergenic
922093153 1:222416857-222416879 GTCATGAAGGGGAAAGAGACAGG + Intergenic
922474816 1:225899468-225899490 GTCATGCAGAGGAAGGAGCCTGG - Intronic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
923099501 1:230801110-230801132 GAGCTGAAGGAGAAGTAGCATGG - Intronic
923415643 1:233757290-233757312 GTGCTGAAGGGCAAAGATCAGGG + Intergenic
923781868 1:237032014-237032036 GTGCTGAAGATGCAGAAGCCGGG - Intergenic
924878981 1:248137154-248137176 GTGCTGAGGCGGGAGGAGACTGG - Intergenic
1062829910 10:598535-598557 GAGCTGTGGGGGGAGGAGCCAGG - Intronic
1063400321 10:5737507-5737529 GGGCCGCAGGGGAAGGAGCACGG - Intronic
1064687080 10:17874059-17874081 GTGCTAAAGAAGAAGGAACCTGG - Intronic
1066251539 10:33637718-33637740 GTGCTGAGAGGGCAGGAGCTTGG + Intergenic
1067232788 10:44423999-44424021 GCCCTGAGGGGGAAGGAGGCTGG - Intergenic
1067413339 10:46084428-46084450 GGCCTGTTGGGGAAGGAGCCAGG + Intergenic
1068463067 10:57351750-57351772 GGGCTGAAGGGGGAGGAAGCTGG - Intergenic
1069782308 10:70964654-70964676 GGGCTGCAGGAGAAAGAGCCGGG - Intergenic
1069881931 10:71598566-71598588 CAGCTGATGGGGAAGGAGGCAGG + Intronic
1070281679 10:75053577-75053599 GTACTAGAGGGGAAGGAGCACGG - Intronic
1070665421 10:78339152-78339174 CTGCAGAAGGGACAGGAGCCTGG - Intergenic
1071420513 10:85492654-85492676 CTGCTGGAAGGGAAGGAGACGGG + Intergenic
1071776683 10:88796912-88796934 GCTCAGAAAGGGAAGGAGCCAGG + Intergenic
1072440937 10:95454525-95454547 GTGGCAAAGTGGAAGGAGCCTGG - Intronic
1073104813 10:101026500-101026522 CTGATGAGGGGGAAAGAGCCAGG + Intronic
1074148468 10:110738141-110738163 GTGCTGAAGAGGAAAGAGGCAGG + Intronic
1074524519 10:114252433-114252455 CTAGTGAACGGGAAGGAGCCGGG + Intronic
1074759418 10:116655138-116655160 GGGCTGAAGGGGGAGGAAGCTGG - Intergenic
1075008969 10:118851974-118851996 GTCCCTAAGGGGCAGGAGCCGGG - Intergenic
1075081158 10:119384798-119384820 ATGATGCAGAGGAAGGAGCCTGG - Intronic
1075984291 10:126770275-126770297 CTGGGGAAGAGGAAGGAGCCAGG - Intergenic
1076109800 10:127851683-127851705 GTGCCCCAGGGGAAGGAGGCAGG + Intergenic
1076740035 10:132478446-132478468 CTGCTGCAGGGGAAGGGGCCAGG - Intergenic
1076801897 10:132834859-132834881 TTGCAGAAGGGGCAGGAGCTCGG - Intronic
1076886885 10:133267100-133267122 GAGTGGAAGGAGAAGGAGCCAGG + Intronic
1077234329 11:1472622-1472644 GTGCTGAAAAGGATGGACCCAGG + Intronic
1077422557 11:2459816-2459838 GTGCTGCATGGGAAGGAGAGTGG - Intronic
1077503318 11:2919046-2919068 GTGCTGGAAGGGAGGGACCCAGG - Intronic
1077921781 11:6646982-6647004 GCGCTGAAGGGGAAACAGGCTGG + Intronic
1078093495 11:8282492-8282514 TGGCTGAAGGGGAGGGAGCATGG - Intergenic
1078668611 11:13345984-13346006 GTGCTGAATGGGAAGGTCCCAGG + Intronic
1078699834 11:13669259-13669281 GTGCTGAGGGAGAAGGCGCGGGG + Intronic
1078862446 11:15262151-15262173 TTGCAGAAGGGCAAGGTGCCTGG + Intergenic
1079093456 11:17496127-17496149 GGGATGAAGGGGAAGGAGGGGGG + Intronic
1079471302 11:20780749-20780771 AAGCTGAAGGAGAAGGAGTCAGG + Intronic
1081026226 11:38018862-38018884 GAGCTGAAGGGGGAGGAAGCAGG + Intergenic
1081520036 11:43872787-43872809 GTGCTGGAGGGGAAAGAGAGAGG + Intergenic
1081667212 11:44923564-44923586 GTGCTTAAGGGAAAGGGGGCTGG - Intronic
1081979113 11:47255135-47255157 GTGCTGTAATGGAAGCAGCCAGG - Intronic
1082162480 11:48900524-48900546 GCGCTGCAGGGGCAGGAGACTGG + Intergenic
1082193522 11:49274441-49274463 GGGCTGAAGGGGGAGGAAGCTGG - Intergenic
1082238943 11:49852212-49852234 GCGCTGCAGGGGCAGGAGGCTGG - Intergenic
1082243199 11:49892118-49892140 GCGCTGCAGGGGCAGGAGGCTGG + Intergenic
1082657699 11:55872943-55872965 GCGCTGCAGGGGCAGGAGGCTGG + Intergenic
1083222445 11:61261915-61261937 GTGCTTCAGGAGAAGGAGCTGGG + Intronic
1083624183 11:64063660-64063682 GTGCTGGATGGGCAGAAGCCTGG + Intronic
1083889517 11:65588939-65588961 GGACAGAAGGGGAGGGAGCCTGG + Intronic
1084278306 11:68068219-68068241 GTGCAGAAGGGGGAAGGGCCCGG + Intronic
1084557562 11:69883923-69883945 CCTCTGGAGGGGAAGGAGCCTGG + Intergenic
1085346906 11:75774122-75774144 GAGCTCATGGGAAAGGAGCCTGG + Intronic
1085579440 11:77637617-77637639 GTGCTGAACGGGAAGGGCCTCGG - Exonic
1085740966 11:79078042-79078064 TTTATGAAGGGGCAGGAGCCTGG + Intronic
1085860809 11:80233046-80233068 GGGCTGAAGGGGAAGGAAGCTGG + Intergenic
1086672616 11:89566747-89566769 GGGCTGAAGGGGGAGGAAGCTGG + Intergenic
1086690894 11:89787569-89787591 GCGCTGCAGGGGCAGGAGGCTGG - Intergenic
1086697627 11:89863941-89863963 GCGCTGCAGGGGCAGGAGGCTGG + Intergenic
1086708532 11:89980547-89980569 GCGCTGCAGGGGCAGGAGGCTGG - Intergenic
1086714907 11:90052086-90052108 GCGCTGCAGGGGCAGGAGGCTGG + Intergenic
1087309388 11:96522072-96522094 GGGCTGAAGGGGAAGAAATCTGG - Intergenic
1088699916 11:112402743-112402765 GTTCTGAAAGGGAAGGTGCGAGG - Intergenic
1088841901 11:113634507-113634529 GTGCAGAAAGGGAAGGAGCAGGG - Intergenic
1089116117 11:116096526-116096548 GTGCTGAAGAGGAAGCAGGGTGG - Intergenic
1089218060 11:116847725-116847747 GTGCTTTAGAGGAAGGAGTCTGG - Intronic
1089571805 11:119416225-119416247 GTGCTGAAGGGGGGGGACCCAGG + Intergenic
1089667980 11:120032411-120032433 CTGCTGAAGGGGTAGGTGGCAGG - Intergenic
1092217782 12:6694909-6694931 GTGTGCAAGGGGCAGGAGCCAGG + Exonic
1092535332 12:9381323-9381345 GTGCAGAATGGGAAGTAGTCAGG - Intergenic
1092914074 12:13173733-13173755 ATGCGGAAGGGGAAGGAGCCAGG + Intergenic
1093197248 12:16143939-16143961 TAGCTGAAGTGGAAGGAGCAAGG + Intergenic
1093481914 12:19612689-19612711 GGGCTGAAGGGGAAGGAAGCTGG - Intronic
1093490584 12:19700350-19700372 GGGCTGAAGGAGGAGGAGCTGGG + Intronic
1094491455 12:30963433-30963455 GCTCTGAAGGGATAGGAGCCAGG + Intronic
1095987950 12:48012069-48012091 TTGCTCAAGAGGACGGAGCCAGG - Intergenic
1096180438 12:49547738-49547760 GTGCTGAGGTGGGAGGAGCAGGG + Intronic
1096650971 12:53061823-53061845 CTGCTGAAGGACAAGGACCCTGG + Exonic
1097014335 12:55974441-55974463 GCGCTGAAGAGGGAGGAGCTGGG + Intronic
1097244707 12:57601070-57601092 GTGCTGAAGGTGAGAGAACCGGG + Exonic
1098599838 12:72317881-72317903 GGGCTGAAGGGGCAGGAGGAAGG + Intronic
1100105980 12:91172611-91172633 GTCCTTAAAGGGAAGGAGCAAGG + Intronic
1101768925 12:107730401-107730423 GTGCTGCAGGGTGAGGAGGCAGG + Intergenic
1102720570 12:115012854-115012876 GTGAAGAAGAGGAAGGAGCCAGG - Intergenic
1102736438 12:115164953-115164975 GAGATGATGGGGAAGCAGCCTGG + Intergenic
1102808499 12:115803207-115803229 GTAATGAAGGGGAAGAAGGCAGG - Intergenic
1103217548 12:119213886-119213908 GGGCTGGATGTGAAGGAGCCTGG - Intronic
1103334451 12:120178757-120178779 GTTCTGAAGAGGAAAGTGCCAGG + Exonic
1103558780 12:121781249-121781271 CGGGTGAAGGGGAAGGGGCCAGG + Exonic
1104371168 12:128225150-128225172 TTGATGAAGGTGAGGGAGCCAGG + Intergenic
1104894929 12:132159411-132159433 GTGCTGCAGGGGACAGACCCCGG - Intergenic
1104986969 12:132602812-132602834 CTGGGGAAGGGGAAGGGGCCTGG + Intergenic
1105551365 13:21398963-21398985 GGGCTGAAGGGGAAAGAGAAAGG + Intronic
1105618199 13:22040755-22040777 GTGCTGTGAGGGAAAGAGCCTGG + Intergenic
1106086873 13:26550731-26550753 GTGGGGAAGGGGAGGGTGCCTGG - Intergenic
1106375498 13:29182910-29182932 CAGCTGAAGGGGAGGGAGCAGGG + Intronic
1107062930 13:36180275-36180297 GTGGTGAAGGGGGAGGAGGCTGG - Intronic
1107175428 13:37394105-37394127 GCAATGAAGGGGAAGGAGACTGG + Intergenic
1109226223 13:59699373-59699395 CAGCTGAAGGGGAGTGAGCCAGG + Intronic
1109272394 13:60268838-60268860 GTGAGAAAGGGGAAGGGGCCGGG + Intergenic
1109326240 13:60870601-60870623 GAGGTGAAGGGGAAGAAGCTGGG - Intergenic
1110872616 13:80470049-80470071 GTGCTGCTGGCGAAGGATCCTGG + Intergenic
1111899927 13:94188277-94188299 GTGCAGAAGGGGAAAGTGCTTGG - Intronic
1112092351 13:96094722-96094744 GTCATGAAGGGGCAGGACCCCGG + Intronic
1113473517 13:110563043-110563065 GTGCTGGCTGAGAAGGAGCCGGG - Intergenic
1113541747 13:111115087-111115109 GAGCGGATGGGGAGGGAGCCGGG - Intronic
1113674123 13:112196372-112196394 GTGCTGAGGAGGCAGGAGCAGGG - Intergenic
1113894458 13:113754880-113754902 GAGCTGGAGGGCAGGGAGCCAGG - Intergenic
1116336563 14:43665300-43665322 TAGCTGAAGGGGAAGGAAGCTGG + Intergenic
1117067209 14:52022826-52022848 GTGGTGAAGGGGCGGGAGCCTGG - Intronic
1117370883 14:55077470-55077492 GTGATAAAGGGGAAAGAGCATGG - Intergenic
1117465176 14:55986148-55986170 GTGGAGAAGGTGCAGGAGCCAGG + Intergenic
1118761902 14:68885246-68885268 CTCCTGGTGGGGAAGGAGCCCGG - Intronic
1119738072 14:76996615-76996637 GTGCTGATGGGAATGGATCCTGG + Intergenic
1120941683 14:89955845-89955867 CTCCGGAAGGGGAAGGGGCCGGG + Intronic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121588603 14:95081874-95081896 GTGCTGAGTGGAGAGGAGCCAGG - Intergenic
1122047769 14:99035834-99035856 TTGCAGAAGGAGAAGGGGCCGGG + Intergenic
1122059022 14:99124412-99124434 GTGGAGAAGGGGAAGGTGCATGG - Intergenic
1122356093 14:101123875-101123897 ATCCTGAAGGGGAAGGCGCCTGG - Intergenic
1122543499 14:102510186-102510208 GTGCAGATGGGGTAGCAGCCTGG - Intergenic
1122935429 14:104953843-104953865 GTGAGGAGGTGGAAGGAGCCGGG - Exonic
1123418798 15:20114389-20114411 GTCCTGGAGGGGCAGGAACCAGG - Intergenic
1123528018 15:21120928-21120950 GTCCTGGAGGGGCAGGAACCAGG - Intergenic
1123695793 15:22878236-22878258 ATGCTGAAGAAGAAGGAGCAAGG + Intronic
1123893825 15:24808946-24808968 GGGCTGAAGGGAAAGGAAGCTGG + Intergenic
1123976618 15:25559850-25559872 GTGATTCAGGGGAAGGAGCACGG - Intergenic
1124492693 15:30167804-30167826 GGTCTGAAGAGGAAGGGGCCTGG + Intergenic
1124689313 15:31808692-31808714 GTGCTGCTGTGGATGGAGCCTGG - Intronic
1124750841 15:32370521-32370543 GGTCTGAAGAGGAAGGGGCCTGG - Intergenic
1125874635 15:43133486-43133508 GTGGTGGCGGGGAAGGAGACCGG - Intronic
1128073703 15:64813014-64813036 CTGCGGAAGGGGAAGGGGCTGGG + Intergenic
1128350538 15:66885485-66885507 GTGCTGAATGGGGAAGGGCCAGG - Intergenic
1128741482 15:70086867-70086889 GTGCAAAAGGGGAAGAAGGCAGG - Intronic
1129274193 15:74434479-74434501 GAGAGGGAGGGGAAGGAGCCAGG - Intergenic
1129582806 15:76830880-76830902 GGGCTGAAGGGGAAGGAAGCTGG + Intronic
1129825894 15:78634828-78634850 GTGCTGAGGGAGGAGGTGCCTGG - Intronic
1129888143 15:79052873-79052895 GTGCTGGTGGGGAAGGACCAAGG + Intronic
1129948077 15:79559553-79559575 GTGCTGAAGCGGGTGGAGTCCGG - Intergenic
1130065074 15:80596282-80596304 GAGCTGGAAGGGAAGGAGGCTGG - Exonic
1130328713 15:82903124-82903146 GGGCTGAAGGGGGAAGAGACCGG + Intronic
1131119787 15:89814953-89814975 GGGCGGACGGGGGAGGAGCCCGG - Intronic
1131225011 15:90617200-90617222 GTGCAGAAGAGGAAGAGGCCAGG - Intronic
1131253138 15:90844076-90844098 GGGCTGAATGGGAAGGAGGGAGG - Intergenic
1131408694 15:92187737-92187759 GTGATGGAGGGGAAGGAGACAGG + Intergenic
1131750415 15:95500595-95500617 GTGCTGAAGTGGGTGGAGCCAGG + Intergenic
1132086247 15:98910667-98910689 GTGCTCTATGGGAAGTAGCCTGG - Intronic
1132303052 15:100788263-100788285 CTGCTGCAGGGGAAGTAGCAGGG - Intergenic
1132382878 15:101378923-101378945 GGGCTGCAGAGGAAGGAGCTGGG - Intronic
1132419216 15:101651389-101651411 TTGCTGAAGGGAAAGAAGCACGG + Intronic
1132645839 16:998894-998916 GTGCTGGTGGGGAAGCAGGCAGG + Intergenic
1132757743 16:1494103-1494125 GCACTGGAGGGGAAGGAGGCGGG + Intronic
1133255636 16:4514187-4514209 GGGCTGAAGGAGAAGGAACCTGG - Intronic
1134021415 16:10923858-10923880 ATGCTGTAGCGGGAGGAGCCAGG - Exonic
1134619234 16:15675120-15675142 GTGCTCAAGGGGCAGGAGGTGGG + Intronic
1134824085 16:17270480-17270502 ATGCTGATAGGGAAAGAGCCAGG - Intronic
1135798939 16:25474642-25474664 GAGCTGAAGGAGAGGTAGCCTGG - Intergenic
1136290512 16:29268652-29268674 GTGGTCAAGGGTGAGGAGCCTGG + Intergenic
1136397278 16:30000181-30000203 GTGGTGAGTGGGAAAGAGCCTGG + Intronic
1137270958 16:46901940-46901962 GTGCAGGGGGGAAAGGAGCCCGG - Intronic
1137593580 16:49708826-49708848 GTGCTGAAGCAGGAGGAGGCAGG - Intronic
1137661967 16:50215314-50215336 GTGCTGAAGTGGATGGACCCTGG + Intronic
1137905860 16:52321290-52321312 GTGCTGAAGGTGGAGAAGCAGGG + Intergenic
1138143275 16:54586557-54586579 ATGATGATGGGGAAAGAGCCAGG + Intergenic
1138512594 16:57517185-57517207 GTGCTGGAGGGGAGTGAGCGGGG - Intronic
1138814950 16:60193425-60193447 GTACAGAAAGGGAAGGAGCTTGG - Intergenic
1138976590 16:62214817-62214839 GGGCTGAAGGGGAAGGAAGCTGG - Intergenic
1139000550 16:62505431-62505453 GAACTAAAGGGGAAGGAGACTGG + Intergenic
1139481091 16:67231105-67231127 GGGGAGAAGGGGGAGGAGCCAGG + Intronic
1139949386 16:70661767-70661789 GTCCTGATGGGAAAGGAGGCAGG - Exonic
1140323073 16:73972652-73972674 GTGCTAATGGGGAGGGAGGCTGG - Intergenic
1140412924 16:74752390-74752412 GGGCTGAAGTGGAAGGAGGTGGG - Intronic
1140893011 16:79300972-79300994 GGGCAGAAGGGGGAGGAGACGGG + Intergenic
1141070937 16:80954235-80954257 GGGCTGATGGGGAAGGAAACTGG + Intergenic
1142096394 16:88242172-88242194 GTGGTCAAGGGTGAGGAGCCTGG + Intergenic
1142142902 16:88480447-88480469 GTGCTGGTGGGGGAGGAGCGGGG + Intronic
1142369758 16:89672332-89672354 GAGCTGGAGGGGAAGGAGGGCGG - Intergenic
1142527578 17:555251-555273 GTCCTGAGGGCGAAGGACCCTGG - Intronic
1143031887 17:3972564-3972586 GTGGTGAAGGGGAAGTGGCGGGG + Intergenic
1143088926 17:4437009-4437031 GTGCTGATGGAGAAGGGACCTGG - Intronic
1143434118 17:6909828-6909850 GGGCTGAAGGGGAGGAAGCTGGG - Intronic
1143591072 17:7885958-7885980 GAGATGAAGGGGGTGGAGCCGGG - Intronic
1144100759 17:11940263-11940285 GGGCTGATAGGGAAGGACCCAGG - Intronic
1144587087 17:16493258-16493280 GGGCTGTAGGGGCAGGAGGCTGG + Intergenic
1144959890 17:19039074-19039096 CTGGTGTGGGGGAAGGAGCCGGG - Intronic
1144975270 17:19135450-19135472 CTGGTGTGGGGGAAGGAGCCGGG + Intronic
1145714647 17:27008380-27008402 CTGTTGAAGGGGAAACAGCCAGG + Intergenic
1146414672 17:32620790-32620812 CTGATGTAGGGGGAGGAGCCAGG + Intronic
1146513307 17:33469292-33469314 GTGCTTCAGGGCAGGGAGCCAGG + Intronic
1146536945 17:33660945-33660967 GAGCTCAAGGTTAAGGAGCCAGG - Intronic
1146634520 17:34494256-34494278 GGGCAGAAGGCGAGGGAGCCTGG + Intergenic
1147050792 17:37793157-37793179 GTGGTGAATGGGGAGGAGTCAGG + Intergenic
1147178109 17:38669326-38669348 GTGCTGGAGGGAGAGGAGGCAGG + Intergenic
1148133171 17:45274451-45274473 CTGCTGGAAGGTAAGGAGCCAGG - Exonic
1148674657 17:49438437-49438459 ACGCTGCAGGGGAAGGAGGCAGG + Intronic
1148791101 17:50173464-50173486 GTGCTGATGTGGAAGGACCGTGG + Intronic
1148858620 17:50592614-50592636 GTGACGAAGGTGATGGAGCCTGG - Intronic
1149549235 17:57527646-57527668 GAGCAGAAGGGGAAGGCCCCAGG + Intronic
1149682255 17:58514623-58514645 GTGCAGAAGGGAGGGGAGCCAGG + Intronic
1151681367 17:75624501-75624523 GTGATGAGGGGGAGGGAGGCTGG - Intergenic
1152464495 17:80458193-80458215 GTGCCGAAGGGCCAGCAGCCTGG + Intergenic
1152623834 17:81379435-81379457 GAGCTGGAGGGGAAGCAGGCGGG + Intergenic
1152697270 17:81803595-81803617 GCTCTGCAGGGGAAGGAACCGGG + Intergenic
1153713124 18:7819885-7819907 ATTTTGAAGGGGAAGGGGCCTGG + Intronic
1153986750 18:10357553-10357575 ATGGTGAAGGGGAAGGAAGCAGG - Intergenic
1154371274 18:13765357-13765379 GGGCTCAAGGGGAAGGAAGCTGG + Intergenic
1155000507 18:21681527-21681549 GAGATGGAGGGGAAGGAGGCTGG - Intronic
1155956986 18:31962563-31962585 GTGGTGGAGAGGAAGGGGCCTGG + Intergenic
1156197221 18:34788552-34788574 GTGCAGAAGGTGCAGGAACCGGG - Intronic
1156464111 18:37337673-37337695 GTGCTGAAGATAAAGGGGCCGGG - Intronic
1156980160 18:43277306-43277328 GTGCTGAAGGGAAAACTGCCTGG + Exonic
1158351062 18:56565068-56565090 CTGCTGAAGAGGAAGCTGCCTGG + Intergenic
1159352010 18:67287077-67287099 GGGATGAAGGGGAAGGAATCTGG - Intergenic
1159564309 18:70031829-70031851 GGGCTGAAGGGGGAGGAAGCTGG + Intronic
1160411485 18:78678073-78678095 GTGCTGAAGCGAAAGCACCCAGG + Intergenic
1160488879 18:79320241-79320263 GTTCTGGGAGGGAAGGAGCCCGG + Intronic
1160699332 19:498423-498445 GTGATGGAGGGGCCGGAGCCCGG - Intronic
1160809426 19:1007061-1007083 ATGTTGATGGGGAAGGAGGCTGG + Intronic
1160912788 19:1482543-1482565 GAGCTGAAGGGGAGGGAGCCCGG - Intronic
1161067923 19:2247682-2247704 GGGCTGGGTGGGAAGGAGCCAGG - Intronic
1161248550 19:3268561-3268583 TGGCTGATGGGGATGGAGCCTGG + Intronic
1161310158 19:3589580-3589602 GAGCTGAAGGTGCAGAAGCCTGG - Intronic
1162050005 19:8027409-8027431 GTGCTGAATGGGAATGAGGATGG - Intronic
1162309800 19:9899455-9899477 GAGCTGATTGAGAAGGAGCCAGG - Intronic
1163201083 19:15769712-15769734 GGCCTGAAGGGGAAGCAGGCAGG + Intergenic
1163320759 19:16573149-16573171 CTGCAGAAGGGGGAGGTGCCGGG + Intronic
1163442345 19:17328433-17328455 GTGGAGAAGGGGCTGGAGCCGGG - Exonic
1163846959 19:19643385-19643407 TTCCTGAATGGGAAGGACCCAGG - Intronic
1164441931 19:28285234-28285256 GAGCTGGAGGGGAAGGAGGGTGG + Intergenic
1164594725 19:29525736-29525758 GTGCAGACTGGGAAGAAGCCAGG + Intergenic
1164830573 19:31317168-31317190 GAGCTGGAGGGGAGGGAGGCTGG - Intronic
1165045008 19:33097830-33097852 GTTCTGAAGGACGAGGAGCCTGG + Exonic
1165144801 19:33724313-33724335 GTGCAGAAGGGGAAGGTGCTGGG + Intronic
1165389294 19:35529240-35529262 GTGCTGGAGGGAAGGGCGCCTGG + Intergenic
1165472803 19:36013305-36013327 GTGCAGAGGGTGAAGGAGGCAGG - Intronic
1166109157 19:40612129-40612151 GTCCTGCACTGGAAGGAGCCGGG - Exonic
1166289692 19:41854564-41854586 GGGCTGAAGCGAAAGGAGCATGG - Intergenic
1167236990 19:48321280-48321302 GTCCTGAAAGGGGCGGAGCCGGG + Intronic
1167326576 19:48830141-48830163 GGGCTGCAAGTGAAGGAGCCAGG - Intronic
1168308515 19:55449697-55449719 CAGCTGAGGGGGAAGGGGCCCGG + Intergenic
1202688312 1_KI270712v1_random:67689-67711 GTCCTGAAGAGGCAGGAACCAGG - Intergenic
925374890 2:3377423-3377445 GATGTGAAGGGGAAGGAGGCAGG + Intronic
926281126 2:11447293-11447315 GTGCAGAAGGGGAAGTCTCCCGG + Intronic
927007075 2:18861766-18861788 GGGCTGAAGGGGGAGGAAGCTGG - Intergenic
927431195 2:23027594-23027616 GTGCCCAAGGAGAGGGAGCCAGG - Intergenic
927658485 2:24971870-24971892 ATGCCGAAGCGGAAGGAGCCCGG - Exonic
927854049 2:26516855-26516877 GTGCTCAAGGTGGAGGGGCCTGG + Intronic
928172916 2:29014813-29014835 TTGCTGAAGGGGTAGGAGGGAGG + Intronic
928216674 2:29367212-29367234 GTGCTGGAGGGTAAGGATTCGGG + Intronic
928314060 2:30232394-30232416 GTGCTGAAGGGGAAGGAGCCCGG + Intronic
928371703 2:30744665-30744687 GTTCTGAAGGATCAGGAGCCTGG - Intronic
929272984 2:39994313-39994335 GTACTGAATGGGAATGTGCCAGG + Intergenic
929398008 2:41545712-41545734 GGGCTCAAGGAGAAGTAGCCAGG + Intergenic
929437348 2:41938869-41938891 GTGCTGAAGGACCAGGAGCCAGG + Intronic
929458123 2:42080673-42080695 GAGCTGAAGGGCAGGGAGCCAGG - Intergenic
930578354 2:53180248-53180270 GGGCTGAAGTGGAAGGGGCAGGG + Intergenic
931557112 2:63518311-63518333 GATCTGAAGGGGAAGGAAGCTGG + Intronic
931646308 2:64424917-64424939 GTACTGGAGGGGAGGGAGCTAGG - Intergenic
931978174 2:67666225-67666247 GTACTGAAGGGGGATGATCCTGG - Intergenic
932571006 2:72938402-72938424 GGCCTGAAGAGGAAGGAGGCAGG + Intergenic
932575492 2:72960275-72960297 GTGCTTAATGAGATGGAGCCAGG - Intronic
932594005 2:73083117-73083139 GTCCTGAAGGGGCAGAAGCCGGG + Intronic
932871688 2:75406634-75406656 GTGCAGAAGGAGACGGAGCATGG - Intergenic
933782450 2:85811784-85811806 TTTCTGCAGGGGAAGGGGCCTGG - Intergenic
933889154 2:86750158-86750180 GTGCTGAAGTGGAATTAGGCTGG + Intronic
934219176 2:90065602-90065624 GGGCTGAAGGGGGAGGAAGCTGG - Intergenic
934475714 2:94592081-94592103 GTGGTGATGAGGAAGGAGCCAGG + Intronic
934475818 2:94592659-94592681 GTGCTGATGAGAAAGGAGCCAGG - Intronic
934735710 2:96688903-96688925 GGGGTGAAGGGGAGGGAGCAGGG - Intergenic
935592178 2:104853881-104853903 GTGGTGAGGGGGAGGGAGGCTGG + Intergenic
936013392 2:108940324-108940346 GGTCTGAAGGGGAAGGTGCAGGG + Intronic
936444427 2:112584998-112585020 GTGATCAAGGGGGAGGAACCTGG - Intronic
936911565 2:117598974-117598996 GTTTTGAAGGGGAAAGAGTCAGG - Intergenic
937017637 2:118620260-118620282 GTGTTCAAGGGGCAGGAGCATGG - Intergenic
937124069 2:119462082-119462104 GTGTTGTAGGGGCAGGAGCCAGG + Intronic
937539023 2:122925684-122925706 GTGCTGAAATGGCAGGGGCCTGG - Intergenic
938251880 2:129821844-129821866 GTGCTGAGAGGGAACGAGCTGGG - Intergenic
939130741 2:138233323-138233345 GTGATGAAAGATAAGGAGCCAGG + Intergenic
940481258 2:154234016-154234038 GAGCTGAAAGGGAAAGAGGCAGG + Intronic
941225117 2:162838766-162838788 GTGGGGAACGGGAAGGAGGCGGG + Intergenic
941540123 2:166771792-166771814 GGGCTGAAGAGGAAGGAAGCTGG - Intergenic
942241094 2:173964654-173964676 GTGGGGGAGGGGAAGGGGCCTGG - Intronic
943114271 2:183646714-183646736 GTGTCCAAGGGGTAGGAGCCTGG - Intergenic
943271969 2:185817012-185817034 GTGAAGAAAGGGAAGGAGCAAGG + Intronic
943455481 2:188102552-188102574 GGGCTGAAGGGGGAGGATGCTGG + Intergenic
945742635 2:213681952-213681974 ACGCTGAAGGGAAAGGAGCCTGG - Intronic
947179559 2:227400095-227400117 GGGATGATGAGGAAGGAGCCAGG - Intergenic
947623605 2:231605709-231605731 GTGCTACTGGGGGAGGAGCCTGG - Intergenic
947634565 2:231673464-231673486 GTGGGGAAGGGGAGGGAGCAGGG - Intergenic
948388992 2:237598632-237598654 ATGCTGGAGGGGACGGAGCAGGG - Intronic
948575468 2:238946916-238946938 GGGCTGAAGGGGCAGGGGGCTGG + Intergenic
948660160 2:239501973-239501995 GTGCTGGAGCAGAAGGAGCTGGG - Intergenic
1168848593 20:961488-961510 GCTCTGCAGAGGAAGGAGCCAGG - Intronic
1168948461 20:1780575-1780597 GTGGAGAATGGGAAGGAGCGTGG + Intergenic
1168985190 20:2042207-2042229 TTTCAGAAGGGGAAGGAGACAGG + Intergenic
1170226299 20:13995308-13995330 GAGCTGGAGGGGGCGGAGCCAGG - Intronic
1170340738 20:15324291-15324313 GAGCTGAAGGGGAAGAATTCAGG - Intronic
1170355281 20:15485730-15485752 GTGGTTAAGAGGAATGAGCCAGG + Intronic
1170510977 20:17076402-17076424 GTGATGAGGGGAAAGTAGCCCGG + Intergenic
1170714100 20:18817287-18817309 GAGATGGAGGGGCAGGAGCCTGG + Intronic
1172092557 20:32444515-32444537 GTGCTGACGGGGAGGGGGACAGG - Exonic
1172114834 20:32567450-32567472 GTGCTGAGGGCAGAGGAGCCAGG + Intronic
1172201775 20:33131978-33132000 GTGCTCACGGCCAAGGAGCCAGG - Intergenic
1172293232 20:33790889-33790911 GTGCTGGTGGGGAAAGAGCCTGG + Intronic
1172852888 20:37979303-37979325 ATGCTGAAGGAACAGGAGCCTGG + Intergenic
1172900221 20:38329279-38329301 GTGCTGAAGAGGCGGGTGCCAGG - Intronic
1173056185 20:39615690-39615712 GTGCTGAAGGGCCAGGGGCATGG + Intergenic
1173649288 20:44652673-44652695 CAGGTGAAAGGGAAGGAGCCGGG + Intergenic
1174873645 20:54206064-54206086 GGGCTGAGAGGGAAAGAGCCTGG - Intergenic
1175392169 20:58634413-58634435 CTGCTGGATGGGCAGGAGCCGGG - Intergenic
1175604176 20:60298870-60298892 GTGCTGATGGGGGATGAGGCTGG - Intergenic
1175850987 20:62092853-62092875 AAACTGAAGGGGAAGGAGACGGG + Intergenic
1176087751 20:63305764-63305786 GTGCTGAGGGCCCAGGAGCCTGG - Intronic
1176993185 21:15522433-15522455 GGGCTGAAGGGGCAGGGGGCTGG + Intergenic
1177323673 21:19555818-19555840 GAGCTGAAGGGGAAAGAGAGAGG + Intergenic
1178028000 21:28490047-28490069 GTGGTGTTGGGGAAGGATCCTGG + Intergenic
1178151880 21:29804303-29804325 ATGCTGATGGGGAAGGAGAGTGG - Intronic
1180013564 21:45068063-45068085 GTTCTGGAGGGGATGGAGGCTGG - Intergenic
1180067595 21:45420441-45420463 GGGCTGCAGGGGGACGAGCCAGG - Intronic
1180786522 22:18550738-18550760 GTGGAGAAGGGGAAGATGCCTGG + Intergenic
1180839444 22:18952307-18952329 GTCCTGGAGGGGCAGGAGCAAGG + Intergenic
1181131803 22:20736461-20736483 GTGGAGAAGGGGAAGATGCCTGG + Intronic
1181243442 22:21490291-21490313 GTGGAGAAGGGGAAGATGCCTGG + Intergenic
1181542093 22:23579133-23579155 GTGCAGACGGGGATAGAGCCCGG - Intronic
1181581201 22:23829061-23829083 GGGCTCAAGGGGAAGGAGGCTGG + Intronic
1181630741 22:24149972-24149994 GGCCTGATGGGGAAGGAACCTGG + Intronic
1182016949 22:27048478-27048500 GGGCTGAAAGGGAAGAAGCATGG + Intergenic
1182809775 22:33105875-33105897 ATGACAAAGGGGAAGGAGCCTGG + Intergenic
1183080682 22:35454176-35454198 GTGGTGAAGGGGAAGGCGTTGGG - Intergenic
1183083533 22:35472603-35472625 GAGCTGCAGGGTCAGGAGCCTGG + Intergenic
1183093825 22:35540739-35540761 GAGGTGAAGGAGGAGGAGCCGGG + Intergenic
1183432386 22:37773629-37773651 GAGCTGCTTGGGAAGGAGCCAGG + Intronic
1183971219 22:41478974-41478996 CTGCAGAAGGTCAAGGAGCCCGG - Intronic
1183987487 22:41577514-41577536 GTTCTGAAGGGGCAGGAGGAGGG - Intronic
1184047486 22:41980577-41980599 GGGGTGAAGTGGAAAGAGCCTGG - Intronic
1184869071 22:47222121-47222143 GTGGAGGAGGGGAAGGAGCTAGG - Intergenic
1184975361 22:48057829-48057851 AGGCTGGAGGGGAAAGAGCCCGG + Intergenic
1185096207 22:48807440-48807462 GGGCTGAAGGACAGGGAGCCAGG - Intronic
1185380239 22:50504558-50504580 CTGCTGCAGGGCAAGGAGCCAGG - Exonic
950113906 3:10438278-10438300 GTGCTGAAGGGGGAGGCCCCAGG + Intronic
950475267 3:13210803-13210825 GGGGAGAAGGGGAAGGAGGCAGG + Intergenic
951258708 3:20481786-20481808 GGGCTGAAGGGGGAGGAAGCTGG + Intergenic
951485558 3:23204667-23204689 GTGCTGCAGGGGAAAGAGAATGG - Intronic
951906328 3:27711817-27711839 TTAGTGTAGGGGAAGGAGCCTGG - Intergenic
952419037 3:33114656-33114678 GGGCTGGATGGGAGGGAGCCAGG - Intronic
952885659 3:38009771-38009793 CTGCTGAAGGGGAAGAAGCTCGG - Exonic
954429143 3:50459958-50459980 GTGCTGAAGAGGATGGAGGGTGG - Intronic
955348163 3:58176105-58176127 GTGCTGAGCGGGAGGGAGGCAGG - Intergenic
956054461 3:65283917-65283939 GTGGTAAAGAGGAAGGAGGCAGG - Intergenic
956414455 3:69012724-69012746 GAGCTGAAGGAAAAGTAGCCTGG - Exonic
956736598 3:72243373-72243395 GTGATGAGGGGAAAAGAGCCAGG + Intergenic
957258875 3:77874688-77874710 ATGTTGAAGGGGAAGGGGTCAGG + Intergenic
957878732 3:86183285-86183307 GGGCTGAAGGAGAAGGAAACTGG + Intergenic
960051450 3:113242556-113242578 AAGCAGAAAGGGAAGGAGCCAGG - Intronic
960130468 3:114050643-114050665 CTGATGGAGGGGAAGGAGACTGG + Intronic
960223603 3:115146328-115146350 ATGCTGAAGAGGCAGGAGGCAGG - Intronic
960922039 3:122757043-122757065 GTGGTGCAGGGGAAGGAACTGGG - Intronic
961390871 3:126551662-126551684 GAGCAGCAAGGGAAGGAGCCAGG - Intronic
961633961 3:128321408-128321430 GTGGAGAGGGGGAAGGACCCAGG + Intronic
961788195 3:129360055-129360077 GGGGAGAAGGGGAAGGAGGCAGG - Intergenic
961825111 3:129595215-129595237 ATGCTGAAGTGGAAGGAGCTGGG - Intronic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962335725 3:134528187-134528209 GGGCTGAAGGGGGAGGAAGCTGG - Intronic
962347190 3:134626673-134626695 GTCATGAAGGGGCTGGAGCCAGG - Intronic
963156289 3:142100671-142100693 GTGAAGAAAGGGAAGGAGGCAGG - Intronic
963401310 3:144802728-144802750 GGGCTGAAGGGGAAGAAAGCTGG - Intergenic
964296635 3:155240540-155240562 GGGCTGAAGGGCAAGGAGGCTGG - Intergenic
965229343 3:166029888-166029910 GAGTTGGTGGGGAAGGAGCCTGG - Intergenic
966312180 3:178606070-178606092 GAACTGAAGGGGAAGGAGATAGG + Intronic
966420798 3:179732423-179732445 GTGCTGGTGGTGAAGGAGCTGGG + Intronic
966886888 3:184381816-184381838 GTGAGAAAGGGGAAGGAGCAAGG + Intronic
967633120 3:191770402-191770424 GGGCTGAAGGGCAAGCAGTCAGG + Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968229738 3:196998362-196998384 GTGCTGAAGTGAGAGGGGCCGGG - Intronic
969155838 4:5209075-5209097 GTGCTGAGGGGGAGGCAGCTGGG - Intronic
969700392 4:8764684-8764706 GTGCTGAAGTTGCAGGTGCCAGG + Intergenic
969854895 4:9991173-9991195 AAGCAGCAGGGGAAGGAGCCAGG - Intronic
973571057 4:52240053-52240075 GTGATGAAGGGGAGGGAGTGTGG - Intergenic
973610592 4:52632712-52632734 AGGCTGAGGTGGAAGGAGCCTGG + Intronic
973729459 4:53809807-53809829 GTGCTGAAGGGGCAAGAACTAGG + Intronic
974273342 4:59681068-59681090 GAGCTGAAGGAGAAGGAACTGGG + Intergenic
975283659 4:72592493-72592515 GTGCTGAATGGTAAAGTGCCTGG + Intergenic
975510914 4:75193388-75193410 GGGCTGAAGGGGAAGTAACCTGG + Intergenic
976833358 4:89340894-89340916 ATTCTGAGGTGGAAGGAGCCTGG + Intergenic
977252626 4:94705604-94705626 TGGCTGAAGGAGAAGGTGCCAGG + Intergenic
977482118 4:97592672-97592694 GGGCTGAAGGGCAAGGAAGCTGG + Intronic
977607238 4:98995606-98995628 GCGCGGGAGGGGGAGGAGCCAGG - Exonic
977696364 4:99971110-99971132 GAGCTGAAGGGGAAGGAAACTGG + Intergenic
977748497 4:100580127-100580149 GATCTGAAGGGGAAAGAGACAGG + Intronic
977768359 4:100827704-100827726 ATGCTGAAAGGGAAGGATACAGG - Intronic
977942514 4:102874322-102874344 CTGCTAAAGGGGAGGGAGGCAGG + Intronic
979156657 4:117401148-117401170 GGGCTGAAGGGGGAGGAAGCTGG + Intergenic
981454173 4:144934060-144934082 GGGCTGAAGGGGAAGAAAGCTGG - Intergenic
984106360 4:175552261-175552283 ATGCTGAAGGGGAAAGATCTGGG - Intergenic
984558072 4:181239192-181239214 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558082 4:181239243-181239265 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558092 4:181239294-181239316 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558102 4:181239345-181239367 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558112 4:181239396-181239418 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558122 4:181239447-181239469 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558132 4:181239498-181239520 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558142 4:181239549-181239571 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558152 4:181239600-181239622 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558161 4:181239650-181239672 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558180 4:181239752-181239774 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558190 4:181239803-181239825 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558200 4:181239854-181239876 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558210 4:181239905-181239927 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558220 4:181239956-181239978 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558230 4:181240007-181240029 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558240 4:181240058-181240080 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558250 4:181240109-181240131 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558260 4:181240160-181240182 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558270 4:181240211-181240233 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558280 4:181240262-181240284 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558290 4:181240313-181240335 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558300 4:181240364-181240386 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558310 4:181240415-181240437 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558320 4:181240466-181240488 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558331 4:181240517-181240539 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558341 4:181240568-181240590 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558371 4:181240721-181240743 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558383 4:181240772-181240794 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558393 4:181240823-181240845 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558413 4:181240925-181240947 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558423 4:181240976-181240998 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558433 4:181241027-181241049 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558443 4:181241078-181241100 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558453 4:181241129-181241151 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558463 4:181241180-181241202 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558473 4:181241231-181241253 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558483 4:181241282-181241304 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558493 4:181241333-181241355 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558503 4:181241384-181241406 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558513 4:181241435-181241457 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558523 4:181241486-181241508 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558533 4:181241537-181241559 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558543 4:181241588-181241610 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558563 4:181241690-181241712 GTGATCACAGGGAAGGAGCCTGG - Intergenic
984558573 4:181241741-181241763 GTGATCACAGGGAAGGAGCCTGG - Intergenic
985016398 4:185639304-185639326 GCGGGGAAGGGGAGGGAGCCTGG + Intronic
985054006 4:186020320-186020342 TGGCTGAAGGAGAATGAGCCAGG + Intergenic
985061884 4:186088318-186088340 GTGCCGAAGGGGATGGAACCAGG + Intergenic
985329608 4:188816616-188816638 GTGCTGATCTGGAAGGAACCTGG + Intergenic
985817115 5:2135326-2135348 GTGCTGGAGGGAAGGGGGCCAGG + Intergenic
985901490 5:2798771-2798793 GTGCTGAAGGAGAAGGCTGCTGG - Intergenic
985979685 5:3452166-3452188 GTGCCGAAGGGAGAGGAGGCTGG - Intergenic
986695657 5:10352982-10353004 GTGCTGACGGGGACAGAGCTTGG + Intergenic
986733195 5:10649839-10649861 GCGCTGCAGGGGCAGGAGGCTGG - Exonic
987500423 5:18701525-18701547 GAGGTGAAAGGGAAGGAGTCTGG + Intergenic
988778216 5:34496284-34496306 GTCCTGAAAGAGAGGGAGCCAGG - Intergenic
989086948 5:37685897-37685919 GGGCTGAAGGGGGAGGAAGCTGG - Intronic
990047050 5:51445367-51445389 GAGAGGAAGGGGAAGGAGCTGGG + Intergenic
990073810 5:51817652-51817674 GTGCTGAGGGGGAAAGAGAAGGG + Intergenic
990809523 5:59706784-59706806 GTGCATAAGGAGAAGGAGCTCGG - Intronic
991577609 5:68121796-68121818 GGGCTGAAGGGGAAGAAAGCTGG + Intergenic
994135804 5:96284547-96284569 GTGTTGGAGTGGAAAGAGCCTGG + Intergenic
996061000 5:119033314-119033336 GTCCTGTAGGGCAAGGGGCCAGG - Intergenic
998162501 5:139821543-139821565 CGGCTGTAGGGGAAGGAGCAAGG + Intronic
998505499 5:142668902-142668924 GGGCTGAAGAGGAAGGGGTCAGG + Intronic
999280744 5:150363782-150363804 GTTCTGCAGGGGGAAGAGCCTGG + Intronic
999442829 5:151615617-151615639 GTGCTGAAGCAGAATGAGTCAGG + Intergenic
999498354 5:152122617-152122639 GTGCTGGAGAGGCAGGAGACAGG - Intergenic
1000878398 5:166668518-166668540 GTGGGGAAGGTGAGGGAGCCGGG - Intergenic
1001125314 5:169013738-169013760 GACCTGAAGGAGTAGGAGCCAGG - Intronic
1001962109 5:175885803-175885825 GTCCTGAAGCAGAAGGACCCTGG - Intergenic
1002076214 5:176710040-176710062 ATGCTGGAGGGGCAGAAGCCTGG - Intergenic
1002925288 6:1602200-1602222 GGACTGAAGGCGGAGGAGCCTGG + Intergenic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1003978917 6:11370968-11370990 ATGAGGAAGGGGACGGAGCCTGG + Intronic
1004038131 6:11944435-11944457 GTGGTGATGGGGAATGAGACTGG + Intergenic
1005905805 6:30260719-30260741 GTCCTGAATGGGAAGAATCCTGG + Intergenic
1005968124 6:30741970-30741992 GAGCTGGAGGGGAAGCAGTCTGG + Intronic
1006084550 6:31586861-31586883 ATGATGGAGGGGAAGGAGCCTGG - Intronic
1006136108 6:31897317-31897339 GTGCTGGAGGGGTTGGTGCCCGG - Intronic
1006718700 6:36136374-36136396 GCCCAGAAGGGGAAGGGGCCTGG + Intronic
1006948442 6:37801200-37801222 GTGCTGAAGGGAGAGGGGGCTGG - Intergenic
1007085883 6:39144920-39144942 GTGGTGGAAGAGAAGGAGCCAGG - Intergenic
1007726720 6:43921289-43921311 AGGCTGGAGGGGAGGGAGCCCGG + Intergenic
1007985350 6:46202349-46202371 GTGATGGAGAGGAAGGAGTCGGG + Intergenic
1008034491 6:46732113-46732135 GAGCTTTAGGGGCAGGAGCCAGG - Intronic
1009276806 6:61692840-61692862 GAGCTGCAGAGGAAGGTGCCTGG + Intronic
1009438843 6:63651704-63651726 TTGGGGAAGGGGAAGGAGCAGGG - Intronic
1010452945 6:76023215-76023237 GGGCAGAAGGGGAAGATGCCAGG - Intronic
1010720218 6:79274838-79274860 TTGCTGAAGGAGATGGAGCTTGG - Intergenic
1011329566 6:86188513-86188535 GGGCTGAAGGGGGAGGTGCTTGG + Intergenic
1011337448 6:86276606-86276628 GGGCTGAAGGGGGAGGAAGCTGG - Intergenic
1011427122 6:87241394-87241416 GTGATGAAGTGGAAAGAGCTTGG + Intronic
1011940928 6:92842272-92842294 GCTTTGAAGGGGAAGGAGCTTGG - Intergenic
1012447516 6:99321948-99321970 GTGAGGAAGGGGAAGAAGCCAGG + Intronic
1012752723 6:103184037-103184059 GGGCTGAAGTGCAAGGAGGCTGG - Intergenic
1013367110 6:109444838-109444860 GTGCCCAAGGGGCTGGAGCCTGG + Intronic
1013432237 6:110065359-110065381 GTGCAGATGGGGAAGGAAACAGG + Intergenic
1013594920 6:111651808-111651830 GTGCTGCATGGGAAGGAGGGAGG + Intergenic
1014315849 6:119863820-119863842 GGGCTAAAGGGGAGGGAGACAGG - Intergenic
1015325395 6:131918375-131918397 GGGCTGGAGGGGAAGAAACCTGG + Intergenic
1015678717 6:135780804-135780826 GGGCTGAAGGGGAAGAAGCTGGG + Intergenic
1016237454 6:141886278-141886300 GGGCTGAAGGGCAAGGAAGCTGG + Intergenic
1016453772 6:144210279-144210301 GGGCTGAAGGGGGAGGAAGCTGG - Intergenic
1016577438 6:145584760-145584782 GGACTGAAGGGGAAGGAAGCTGG - Intronic
1018468839 6:164079227-164079249 AGGATGAAGGGGAAGCAGCCAGG + Intergenic
1018650792 6:165989543-165989565 GTGCGTAATGGGAAGGACCCAGG - Intergenic
1018669336 6:166166821-166166843 GTGCTGAAGGTGAACGTGTCTGG - Exonic
1018699757 6:166416982-166417004 GGGCTGAAAGAGAAGGAGTCAGG - Intronic
1019017139 6:168888134-168888156 GTGACGATGGGGAAGGGGCCGGG + Intergenic
1019278065 7:186545-186567 GTGCTGACGGGCAATGGGCCTGG - Intergenic
1019281265 7:201456-201478 GTGCTCATGGGGATGGAGACTGG - Intronic
1019532704 7:1511610-1511632 GTGAGGAAGGGGAAGGACTCTGG + Intergenic
1019576381 7:1739631-1739653 GTGGGGAAGGTGAAGGAGGCTGG + Intronic
1019706182 7:2498248-2498270 GTCCTGATGAGGAAGCAGCCGGG - Intergenic
1019990049 7:4683852-4683874 GTGCTGAAGGAGCAGAGGCCTGG + Intronic
1020408908 7:7868414-7868436 GTGCAGAAGGGGAAGTAAGCAGG - Intronic
1021425502 7:20495498-20495520 GGGCTGAAGGGGAAGGAAGCTGG + Intergenic
1023530107 7:41144197-41144219 GTGATGAAAGGGAAGGAGTATGG - Intergenic
1023743298 7:43300377-43300399 GTGATGACAGGGAAGGAACCTGG + Intronic
1023822500 7:43987963-43987985 GTGCTGCAGGGGATGGGGCTGGG - Intergenic
1023981479 7:45073172-45073194 GTTGGGCAGGGGAAGGAGCCAGG - Intronic
1024222106 7:47297183-47297205 ATGTTGAAGGACAAGGAGCCGGG - Exonic
1024266433 7:47610389-47610411 GAGCTGGAGCGGAGGGAGCCAGG + Intergenic
1024281905 7:47725316-47725338 ATGCTGAAGGGCATGGGGCCTGG + Intronic
1026447612 7:70499240-70499262 CTGCTGAAGGGAAAGGAGAAGGG + Intronic
1026576101 7:71572891-71572913 GTGCTGCTGGGGAAGGACCCAGG - Intronic
1026843495 7:73683902-73683924 GTGCGGGAAGGGAAGGACCCGGG + Intronic
1027189417 7:75988752-75988774 GGGCTGGAGGGGAAGAAGGCCGG + Intronic
1027733686 7:81906527-81906549 GAGCTGAAAGGGAAGGAAGCTGG + Intergenic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1029750764 7:102541378-102541400 GTGCTGCAGGGGATGGGGCCGGG - Intronic
1029768719 7:102640489-102640511 GTGCTGCAGGGGATGGGGCCGGG - Intronic
1030807781 7:113937670-113937692 GGGCTGAAGGGGAGGAAGCTGGG - Intronic
1031329956 7:120452505-120452527 GGGCTGAAGGGGAAGGGAGCTGG + Intronic
1032022737 7:128418892-128418914 GTGCTGGAGGGGAGTGAGCTGGG + Intergenic
1032085295 7:128880526-128880548 GAGCTGAAGGGATAGGAGCTGGG + Exonic
1032310388 7:130780621-130780643 GGGCTGAAGGCAAAGGAGGCTGG - Intergenic
1032537854 7:132679188-132679210 GTGGTGAACGGGAAAGAACCTGG + Intronic
1032558155 7:132859687-132859709 GGACTGAAGGGGAAGGAGGCAGG - Intronic
1033109698 7:138563167-138563189 GGGCCTAAGGAGAAGGAGCCTGG + Intronic
1033494238 7:141877505-141877527 GTTCTAAAGGGGAAGGAAGCTGG - Intergenic
1034990392 7:155544338-155544360 GGGCTGGAAGGGGAGGAGCCGGG - Intergenic
1036496762 8:9277171-9277193 CTGCCAGAGGGGAAGGAGCCTGG - Intergenic
1036579684 8:10062213-10062235 CTGCTGCATGGGAAGGAGCCTGG - Intronic
1036783003 8:11662903-11662925 GGGCTGGGGGGGAAGGAGCCAGG - Intergenic
1036966206 8:13301008-13301030 GTGTAGAAGGTGGAGGAGCCTGG + Intronic
1037671092 8:21015981-21016003 GTCCTGTAGGGCAAGGCGCCTGG + Intergenic
1037907661 8:22724930-22724952 GTGCCGGTGGGGAGGGAGCCTGG + Exonic
1038170545 8:25127964-25127986 GGGCTGAAGGGGGAGGAAGCTGG + Intergenic
1038507047 8:28093234-28093256 GTGCGAAAGGGGAAGGAGATGGG + Intronic
1038610232 8:29054217-29054239 TTACTGAAGGGAAAGCAGCCAGG + Intronic
1038785625 8:30612655-30612677 GTGCTGAGAGGGAGGGAGGCAGG - Intronic
1039638760 8:39195101-39195123 GGGCTGAAGGGGGAGGAAGCTGG - Intronic
1039672000 8:39612290-39612312 GTGCTGAATGGGGAGGAAGCTGG + Intronic
1040668404 8:49658223-49658245 GGGCTGAAGGGGGAGGAAACTGG + Intergenic
1041098526 8:54373455-54373477 GTGTTGAAGGGGAGTGAGCCCGG + Intergenic
1041404501 8:57483335-57483357 GGCCTGAAGGGGGAGGAACCTGG + Intergenic
1041527966 8:58829564-58829586 GTGTTGAAAGGGGAGTAGCCTGG + Intronic
1041641381 8:60206657-60206679 ATGATGAAGGGGCAGGAGCTAGG - Intronic
1042104684 8:65313896-65313918 GTGCTGAAGGGGCAGCAGTGGGG - Intergenic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1045525757 8:102940195-102940217 GTGCTGAAGCGGAAGGGGTTCGG + Intronic
1046092373 8:109518921-109518943 GGTCTGGAGTGGAAGGAGCCAGG + Intronic
1046216414 8:111153020-111153042 GTGCTGAAGCGGGAGGAAGCTGG - Intergenic
1046597129 8:116273547-116273569 GGGCTGAAGAGGAAGGAAGCTGG - Intergenic
1047168421 8:122466277-122466299 GGGCTGAAGGGGGAGGAAGCTGG + Intergenic
1048469518 8:134695062-134695084 GGGCTTCAGGGGAGGGAGCCAGG + Intronic
1048860698 8:138722769-138722791 CTGGTGTAGTGGAAGGAGCCTGG - Intronic
1049127983 8:140810006-140810028 GGGCTGAAGGGGGAGGAAGCTGG + Intronic
1049190952 8:141287105-141287127 GTGTAGAAGTGGAAGGAACCGGG - Intronic
1049645307 8:143733425-143733447 GAGCCGAGGGGGAAGGGGCCCGG - Intronic
1050003280 9:1101096-1101118 TTGCTGAAAGGGAAGTGGCCGGG - Intergenic
1050506493 9:6354180-6354202 TTCCTGCAGGGGCAGGAGCCCGG - Intergenic
1050824354 9:9926388-9926410 GTGTTGAAGGGGATAAAGCCAGG + Intronic
1051542751 9:18238416-18238438 GAGTTGTAGGGGAAGGAGCTGGG + Intergenic
1052854237 9:33397258-33397280 GTGCTGATGAGAAAGGAGCCAGG + Intronic
1052854343 9:33397836-33397858 GTGGTGATGAGGAAGGAGCCAGG - Intronic
1053287546 9:36859593-36859615 GTGAGGAAGGGTGAGGAGCCGGG - Intronic
1053310987 9:37019568-37019590 CAGATGAAAGGGAAGGAGCCAGG + Intronic
1053530695 9:38878559-38878581 GGGCTGAAGGGGGAGGAAGCTGG + Intergenic
1053682247 9:40493419-40493441 GTGCTGATGAGAAAGGAGCCAGG + Intergenic
1053682351 9:40493997-40494019 GTGGTGATGAGGAAGGAGCCAGG - Intergenic
1053807509 9:41817848-41817870 GGGCTGAAGGGGGAGGAAGCCGG - Intergenic
1053932231 9:43121746-43121768 GTGCTGATGAGAAAGGAGCCAGG + Intergenic
1053932332 9:43122323-43122345 GTGGTGATGAGGAAGGAGCCAGG - Intergenic
1054202918 9:62102992-62103014 GGGCTGAAGGGGGAGGAAGCTGG + Intergenic
1054281363 9:63130932-63130954 GTGGTGATGAGGAAGGAGCCAGG + Intergenic
1054281467 9:63131510-63131532 GTGCTGATGAGAAAGGAGCCAGG - Intergenic
1054295345 9:63328919-63328941 GTGCTGATGAGAAAGGAGCCAGG + Intergenic
1054295449 9:63329497-63329519 GTGGTGATGAGGAAGGAGCCAGG - Intergenic
1054393363 9:64633423-64633445 GTGCTGATGAGAAAGGAGCCAGG + Intergenic
1054393468 9:64634001-64634023 GTGGTGATGAGGAAGGAGCCAGG - Intergenic
1054428012 9:65138637-65138659 GTGCTGATGAGAAAGGAGCCAGG + Intergenic
1054428118 9:65139215-65139237 GTGGTGATGAGGAAGGAGCCAGG - Intergenic
1054502261 9:65882329-65882351 GTGGTGATGAGGAAGGAGCCAGG + Intronic
1054502366 9:65882907-65882929 GTGCTGATGAGAAAGGAGCCAGG - Intronic
1054623083 9:67369579-67369601 GGGCTGAAGGGGGAGGAAGCCGG + Intergenic
1054809194 9:69421469-69421491 GTCCTGGAGGGGAAGGGTCCGGG - Intergenic
1055771047 9:79717424-79717446 TTGCTGGAGGGGAAGGAGGTGGG - Intronic
1055941913 9:81658634-81658656 GTTGTGCAGGTGAAGGAGCCAGG - Intronic
1056451515 9:86721688-86721710 GTCCTGCAGGGGAAGCTGCCAGG + Intergenic
1056828950 9:89898823-89898845 GAGCTGAATGGGCTGGAGCCGGG + Intergenic
1057132787 9:92666344-92666366 AAGCTGAAGGCGAAGGAGGCAGG + Intronic
1058323459 9:103663558-103663580 GGGCTGAAGGGGTAGGAAGCTGG + Intergenic
1058791406 9:108449451-108449473 ATGCAGAGGGGAAAGGAGCCAGG - Intergenic
1059067157 9:111097408-111097430 GTGAAGAAGGGAAAGGAGGCTGG - Intergenic
1059430851 9:114249478-114249500 GGGCTGGAGGGGAAGGTGCGTGG + Intronic
1059691324 9:116688003-116688025 GTGCATAAGAGGAAGGAGCAGGG + Intronic
1061419608 9:130466201-130466223 GGGCTCAAGGGGAATGAGCTTGG + Intronic
1061734070 9:132640389-132640411 TTGCTGAAGGGTAGGGAGCAAGG + Intronic
1062344969 9:136110397-136110419 GGGCTGAGGGGGAAGGTGCCCGG - Intergenic
1062439704 9:136564227-136564249 GTGCTCAAGGGGAGGGGCCCAGG + Intergenic
1062723951 9:138060723-138060745 GGGCAGAACAGGAAGGAGCCTGG - Intronic
1186899106 X:14033850-14033872 ATGCTGATGGGGAAGAAGCCAGG - Intergenic
1188833658 X:34931479-34931501 GGGCTGAAGGAGAAGGAAGCTGG + Intergenic
1188841702 X:35025030-35025052 GAGCAGAAGGAGAAGCAGCCAGG + Intergenic
1188988440 X:36788996-36789018 GAGCAGAAGGAGAAGCAGCCAGG - Intergenic
1189248366 X:39580876-39580898 CAGCTGAAGGGAAAGGAGTCTGG - Intergenic
1189653117 X:43211296-43211318 GTGCTGCAAGGCAAGGACCCTGG - Intergenic
1191643429 X:63452629-63452651 GAGCTGAAGGGAAAGGAAGCTGG + Intergenic
1191655067 X:63586960-63586982 GGGCTGAAGGGGAAGAAAACTGG - Intergenic
1191816646 X:65253227-65253249 GGGCTGAAGGAGAAGGAAGCAGG + Intergenic
1192953532 X:76043933-76043955 ATCCTGAAGGGGATGGAGCAGGG + Intergenic
1193276232 X:79590863-79590885 GGGCTGAAGGGGGAGGAACCTGG - Intergenic
1193823407 X:86194485-86194507 GGGCTGAAGGGGAAACAACCTGG + Intronic
1194019110 X:88665707-88665729 GGGCTGAAGGGGGAGGAATCTGG + Intergenic
1194286601 X:92019115-92019137 GGGCTGAAGAGGAAGGAAGCTGG + Intronic
1194552702 X:95321011-95321033 GTGCTGAAAGGGAAAGACACTGG + Intergenic
1195451802 X:105022558-105022580 GAGCTGAAAGTCAAGGAGCCTGG - Intronic
1195614655 X:106902891-106902913 AAGCTGAAGGTGAAGCAGCCAGG - Intronic
1196520653 X:116667517-116667539 CTACGGAAGGGGAAGGCGCCTGG + Intergenic
1196554312 X:117069715-117069737 GTGCTGAAGGGGGAGGAAGCTGG + Intergenic
1196982740 X:121232570-121232592 GGGCTGAAGGGAAAGGAAGCTGG - Intergenic
1197177488 X:123500930-123500952 GGGCTGAAGGGGGAGGAAGCTGG - Intergenic
1199270210 X:145873602-145873624 GGGCTGAAGGGGGAGGAAGCTGG - Intergenic
1199640635 X:149858050-149858072 GGGCTGAAGGGGGAGGAAGCTGG + Intergenic
1200000146 X:153056121-153056143 GTGCGGGAGGGGCAGGAGCCGGG + Intergenic
1200033101 X:153312157-153312179 GTGCTGAAGGGTTTGGAGCCTGG - Intergenic
1200604147 Y:5243675-5243697 GGGCTGAAGAGGAAGGAAGCTGG + Intronic
1200684081 Y:6244850-6244872 GGGCTGTTGGGGGAGGAGCCAGG - Intergenic
1201048554 Y:9909536-9909558 GGGCTGTTGGGGGAGGAGCCAGG + Intergenic
1201489100 Y:14522814-14522836 TTCCCGAAGGGGAAGGCGCCTGG + Intronic
1202110161 Y:21409382-21409404 GTACTGCAGGGGATTGAGCCTGG - Intergenic
1202131916 Y:21620701-21620723 ATCCTGGAGGGGAAGGAGTCAGG - Intergenic
1202196743 Y:22305704-22305726 GTACTGCAGGGGACTGAGCCTGG + Intergenic