ID: 928317736

View in Genome Browser
Species Human (GRCh38)
Location 2:30258891-30258913
Sequence CTGCTGTCCTTACTCAACAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928317724_928317736 26 Left 928317724 2:30258842-30258864 CCCATGTTGTTCCCGGACAAGGG 0: 1
1: 0
2: 0
3: 1
4: 47
Right 928317736 2:30258891-30258913 CTGCTGTCCTTACTCAACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 108
928317726_928317736 25 Left 928317726 2:30258843-30258865 CCATGTTGTTCCCGGACAAGGGC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 928317736 2:30258891-30258913 CTGCTGTCCTTACTCAACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 108
928317722_928317736 27 Left 928317722 2:30258841-30258863 CCCCATGTTGTTCCCGGACAAGG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 928317736 2:30258891-30258913 CTGCTGTCCTTACTCAACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 108
928317731_928317736 14 Left 928317731 2:30258854-30258876 CCGGACAAGGGCAGAAGGGAGGC 0: 1
1: 0
2: 1
3: 34
4: 268
Right 928317736 2:30258891-30258913 CTGCTGTCCTTACTCAACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 108
928317729_928317736 15 Left 928317729 2:30258853-30258875 CCCGGACAAGGGCAGAAGGGAGG 0: 1
1: 0
2: 6
3: 39
4: 450
Right 928317736 2:30258891-30258913 CTGCTGTCCTTACTCAACAGTGG 0: 1
1: 0
2: 0
3: 12
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928317736 Original CRISPR CTGCTGTCCTTACTCAACAG TGG Exonic
900364887 1:2307229-2307251 CTGCTGTCCTCACGCAGCCGCGG - Exonic
901689135 1:10961153-10961175 TTGCTGTCCTCACACGACAGTGG - Intronic
903999645 1:27331674-27331696 CTGGCCTCCTGACTCAACAGTGG - Intronic
904611775 1:31729749-31729771 CTGATGTCCGCCCTCAACAGTGG + Intronic
906567952 1:46813898-46813920 CTGCTGTCCCTGCTAAGCAGAGG - Exonic
909042514 1:70670913-70670935 CAGCTTACTTTACTCAACAGTGG + Intergenic
910675183 1:89809044-89809066 TAGCTGTCCTTACTCATCAAAGG - Intronic
916723059 1:167499514-167499536 CAGCTGCCCTTATTCAAGAGTGG + Intronic
916728215 1:167542906-167542928 CTGCTGCCCAGACTTAACAGTGG + Intronic
917035883 1:170746412-170746434 CTGCTGTCCTTGCTCCCCACGGG - Intergenic
917981252 1:180271163-180271185 CTGCTGTCCTCACTTTTCAGTGG + Intronic
918449321 1:184643644-184643666 CAGCTGTCCTTATTCAGCAGAGG + Intergenic
922051458 1:221994430-221994452 CAGCTTTCCTGACTCCACAGTGG - Intergenic
1063710205 10:8469966-8469988 CTGCTGTTCTCACTCATAAGTGG + Intergenic
1073314068 10:102566037-102566059 CTACTGTCCTAACTCTCCAGCGG - Intronic
1073834942 10:107430542-107430564 CTGCTGTCCCTACTGTCCAGAGG + Intergenic
1076980154 11:199845-199867 CTGCTGTCCTTCCTGAACCTGGG - Intronic
1081650085 11:44818103-44818125 CTGCTCTCCTGACTTAACACAGG - Intronic
1087924846 11:103907890-103907912 CTGATGTTTTTACTCAAGAGGGG - Exonic
1088976128 11:114817923-114817945 CTGCTGTCCTGCATGAACAGGGG + Intergenic
1090561085 11:127933490-127933512 CGGCTGTCATTACACAACAATGG + Intergenic
1092680411 12:10973667-10973689 CTGCTGTATCTACTCAAGAGTGG - Intronic
1093417849 12:18941056-18941078 CTCCTTTCCTCAGTCAACAGTGG - Intergenic
1094846077 12:34361976-34361998 CTGCGTTCCTTACTCAACACAGG + Intergenic
1101751606 12:107586667-107586689 CAGCTGTCCTCACTTAACAGAGG + Intronic
1107423993 13:40275081-40275103 CTGCTGTCCTCCCACCACAGTGG + Intergenic
1107996803 13:45869183-45869205 CTCCTGTCCTCACACAACAATGG + Intergenic
1114634162 14:24178071-24178093 CTGCCCTCCCCACTCAACAGAGG + Exonic
1115163755 14:30424825-30424847 CTGCTGTCTGTTCTCAACATCGG - Intergenic
1116908767 14:50434627-50434649 CTGTTGACTTTATTCAACAGTGG - Intronic
1118496594 14:66313759-66313781 CTGCTGTCCTTACAAAAAGGGGG - Intergenic
1119729538 14:76942216-76942238 CTGCTGTCCTTAGCCAGCAGAGG + Intergenic
1121525270 14:94615132-94615154 TTTCTGTCCTGACTCAACAATGG + Intronic
1125471001 15:40003579-40003601 CTGCTGTGGTCACTCAACACTGG - Intronic
1125965293 15:43870097-43870119 CTGCTGTTCTTACTCAAGCCTGG - Intergenic
1129618131 15:77116321-77116343 CTGCTCTCCCTCCTCAGCAGAGG + Intronic
1130146375 15:81276872-81276894 CTGCTGACTCTCCTCAACAGTGG - Intronic
1131966308 15:97847832-97847854 CTCATGTCCTTACTCATCACTGG - Intergenic
1141893943 16:86946688-86946710 CTGCAGCCCTTACTCACCCGAGG - Intergenic
1142059798 16:88021812-88021834 CGGCTGTCCTCACTCAACCCAGG + Intronic
1143328984 17:6120291-6120313 CTCCTGTCCTCACTCTAGAGTGG + Exonic
1143759041 17:9088012-9088034 CTGCTGTCCTTCCTCCCCAGAGG + Intronic
1143860812 17:9889520-9889542 CTGCAGCCCTCACTTAACAGTGG + Exonic
1144280387 17:13720407-13720429 GTGCTATCCTCATTCAACAGAGG + Intergenic
1146937595 17:36822016-36822038 CTGCTTTCCTTGCTCAGCTGGGG + Intergenic
1149946017 17:60928208-60928230 ATGCTGTCCTTCCTCCACAAAGG - Intronic
1152568871 17:81112535-81112557 CCGCTGTCCATACTCGTCAGCGG + Intronic
1153452136 18:5241147-5241169 CTGCTTCCCCTTCTCAACAGGGG - Intergenic
1157287551 18:46387357-46387379 CTGCTTTCCTTACTTCAGAGTGG - Intronic
1161672420 19:5621761-5621783 CTGCTGTTCCTCCTCACCAGCGG - Intronic
1165555729 19:36630240-36630262 GTGCTGTCATTTCTCAACAAAGG + Intergenic
925792242 2:7502534-7502556 CTGCTGTACTTCCTCCACTGTGG + Intergenic
928317736 2:30258891-30258913 CTGCTGTCCTTACTCAACAGTGG + Exonic
929236220 2:39608031-39608053 CTTCTGTCCTAACTGAACACTGG + Intergenic
933365052 2:81342555-81342577 CTGCTGTCCTTTCCTAACGGTGG - Intergenic
937877588 2:126837111-126837133 TTGCTGTTCCTACTAAACAGAGG + Intergenic
941656308 2:168148419-168148441 CTGCTGTCCTGACTCAAAGGAGG + Intronic
945335607 2:208589136-208589158 CCCCTGTCCTTACTCAAGAGAGG + Intronic
1169902385 20:10566689-10566711 CAGCTGGCCTTACTCAATGGTGG - Intronic
1175820435 20:61906258-61906280 CTGCTTTCCTGCCCCAACAGTGG - Intronic
1178817574 21:35945808-35945830 CTGCTGTCCTTACAAAAAAGGGG + Intronic
1179606102 21:42516235-42516257 CTGCTGCCCTTTCTCTGCAGGGG + Intronic
1183239110 22:36642672-36642694 CATCTGTCCTTAGACAACAGGGG + Intronic
1183279454 22:36924209-36924231 CTGCTGCTCTGACACAACAGGGG + Intronic
952690585 3:36200596-36200618 CTTCTGTCCCTAGGCAACAGAGG + Intergenic
953815842 3:46155419-46155441 CTGCTGTCCTTTCTCTACTGTGG - Intergenic
955053544 3:55435655-55435677 CTGATGTCATTAATCACCAGTGG - Intergenic
955752583 3:62197536-62197558 CTGCAGTCCTTCCTCGACACAGG - Intronic
958989024 3:100820066-100820088 CTCCTTTGCTAACTCAACAGGGG + Intronic
961115708 3:124328023-124328045 CTCGTGTGCTTACTAAACAGTGG + Intronic
961769809 3:129240707-129240729 CTGCTTTTCCTACTCTACAGTGG + Intergenic
963669111 3:148229946-148229968 CTGGTGTCCTTATTAAAAAGAGG - Intergenic
963749638 3:149163171-149163193 CATCTGTCCTTCCTCAGCAGAGG + Intronic
964329795 3:155589775-155589797 CTGCTGTCATTGCTAAAAAGAGG - Intronic
975450990 4:74526628-74526650 ATTCTGTCCTTACTCAAAACAGG + Intergenic
980806401 4:137820243-137820265 CTGCTCTCCATTCTCACCAGAGG - Intergenic
982480305 4:155900708-155900730 CTCTTTTCCTTACTCAACAGTGG - Intronic
983195781 4:164804844-164804866 CGGCTGTTCTTATTCAAAAGGGG + Intergenic
983213448 4:164980699-164980721 CTCATGTTCTTACTCAAAAGTGG + Intergenic
986007023 5:3676991-3677013 CTGCAGTCCTTCCTCAACCCTGG + Intergenic
993567981 5:89498977-89498999 CTGCTGTCGTTATTAAACACAGG + Intergenic
997646684 5:135486834-135486856 CTGCTGTCCCCATTCTACAGAGG + Intergenic
997977730 5:138450023-138450045 CTCCTGTCCTTACCGGACAGCGG + Intergenic
1004571031 6:16845321-16845343 CTCTGGTCCTTATTCAACAGGGG - Intergenic
1006119334 6:31794921-31794943 CGGCTGTCCTTGTCCAACAGTGG - Exonic
1010942419 6:81934269-81934291 CTGTTTTCCTAACTTAACAGAGG - Intergenic
1014109833 6:117608194-117608216 ATGGTGTCCTCACTCAACTGAGG + Intergenic
1016006448 6:139093627-139093649 CTACTGACCTTTCTCAACTGGGG - Intergenic
1016660049 6:146567676-146567698 CTGATGTCCTTACTAAAAGGTGG + Intergenic
1022048293 7:26640981-26641003 CTGCTGACTGTACTTAACAGTGG - Intronic
1024000816 7:45188333-45188355 CTCCTGTCCTTACTCACTGGGGG + Intergenic
1024638861 7:51313682-51313704 CTTCTGTCCTTTATTAACAGAGG + Intronic
1025809631 7:64867426-64867448 CTACTGTCCTTACTTTATAGAGG + Intergenic
1027438668 7:78194943-78194965 CTCCTTTCCTGACTCAACAGAGG - Exonic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1031969729 7:128055392-128055414 CTGCTGCCATTACTCTGCAGAGG - Intronic
1032300171 7:130679448-130679470 CTTCTGTTCTTACCCCACAGAGG - Intronic
1035849225 8:2897662-2897684 CTACTGTCATTATTCATCAGGGG + Intergenic
1036079672 8:5541467-5541489 CTGCTTTCCCTCTTCAACAGTGG + Intergenic
1037578914 8:20233177-20233199 CTGGTGTCCTTATTTAAAAGCGG + Intergenic
1038882622 8:31631476-31631498 ATGCTTTCTTTACTCAGCAGTGG + Intergenic
1041330372 8:56717686-56717708 CCCCTTTCCTTACTCAACACGGG - Intergenic
1042208428 8:66352421-66352443 CTGCTGTCCTTAACAAAGAGAGG - Intergenic
1045472594 8:102525635-102525657 CTGGTGTCCTTACAAGACAGAGG + Intergenic
1048679536 8:136824489-136824511 CTGTGTTCCTTACTCAACTGCGG - Intergenic
1049045413 8:140147343-140147365 GTGCTGCCCTCACTCAACAAAGG - Intronic
1052103397 9:24479880-24479902 CTGCTGTGCTGAGTAAACAGAGG - Intergenic
1052450538 9:28624811-28624833 CTGGTGCCCTTACTCTACTGTGG + Intronic
1057055190 9:91955043-91955065 CTGTTGTCCTCACCCCACAGTGG + Intergenic
1058957414 9:109961955-109961977 CTGCTGCCCACACTCATCAGTGG + Intronic
1059653603 9:116337313-116337335 CTGCTGTCCTTTCCCCACTGGGG - Intronic
1060621089 9:125067369-125067391 CTGCTGTCCTTAAAGAGCAGAGG + Intronic
1185498307 X:576371-576393 CAGCTGTCCTTACTCCTCACTGG - Intergenic
1186244103 X:7602356-7602378 CTTCTGTCTTTACTCACAAGTGG - Intergenic
1187988635 X:24844777-24844799 GTGCTGCCCTTACTGAACAGTGG + Intronic
1188176334 X:26995344-26995366 CTGCTGTGCTTGTTCCACAGTGG - Intergenic
1190357185 X:49616898-49616920 CTGCTGACCTTCAACAACAGAGG - Intergenic
1192236160 X:69297459-69297481 CTGCTCACCTTTCTCTACAGAGG + Intergenic
1192629786 X:72768465-72768487 TTTCTGGCCTTACTCAACACAGG + Intergenic
1192651924 X:72952339-72952361 TTTCTGGCCTTACTCAACACAGG - Intergenic
1195863914 X:109409198-109409220 CAGCTGTCCTGTCTCAACTGGGG + Intronic