ID: 928318934

View in Genome Browser
Species Human (GRCh38)
Location 2:30268196-30268218
Sequence TACAGTAGTGTGCAACCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928318930_928318934 -6 Left 928318930 2:30268179-30268201 CCAGCCCCGAGTAGAGCTACAGT 0: 1
1: 0
2: 1
3: 7
4: 61
Right 928318934 2:30268196-30268218 TACAGTAGTGTGCAACCCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 84
928318928_928318934 11 Left 928318928 2:30268162-30268184 CCCGAGGAGATGATGCTCCAGCC 0: 1
1: 0
2: 0
3: 19
4: 211
Right 928318934 2:30268196-30268218 TACAGTAGTGTGCAACCCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 84
928318931_928318934 -10 Left 928318931 2:30268183-30268205 CCCCGAGTAGAGCTACAGTAGTG 0: 1
1: 0
2: 0
3: 1
4: 34
Right 928318934 2:30268196-30268218 TACAGTAGTGTGCAACCCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 84
928318929_928318934 10 Left 928318929 2:30268163-30268185 CCGAGGAGATGATGCTCCAGCCC 0: 1
1: 0
2: 3
3: 26
4: 261
Right 928318934 2:30268196-30268218 TACAGTAGTGTGCAACCCCAAGG 0: 1
1: 0
2: 1
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928318934 Original CRISPR TACAGTAGTGTGCAACCCCA AGG Intronic
903009046 1:20317602-20317624 CACCGAAGTGTCCAACCCCATGG + Exonic
905956656 1:42002711-42002733 TACAGGAGAGTGGAACCCCAGGG - Intronic
907977309 1:59444506-59444528 TACAGTGGTATAGAACCCCATGG - Intronic
911341337 1:96642597-96642619 TACAGTAATATGCAACAACATGG - Intergenic
917441643 1:175073881-175073903 AGCAGGAGTGTGCCACCCCAAGG - Intronic
920823167 1:209400453-209400475 TGCAGTACTGTGCCTCCCCAGGG - Intergenic
1062889288 10:1045740-1045762 TACAGGAGTGAGCCACCACACGG + Intronic
1065141600 10:22723653-22723675 CACAGAAGTCTGCAAACCCACGG + Intergenic
1065341688 10:24712656-24712678 TCCACGAATGTGCAACCCCATGG + Intronic
1079374765 11:19881988-19882010 CACAGCAATGTGCAACTCCAGGG - Intronic
1083920541 11:65779807-65779829 TCCACTAGTGTCCAATCCCAGGG + Exonic
1086643515 11:89189863-89189885 TACAGTAGTATGCCACACAATGG + Intronic
1089807364 11:121103492-121103514 AACCATAGTGTGAAACCCCACGG + Intronic
1091976207 12:4827621-4827643 GACAGCAGTGAGCAGCCCCAAGG + Intronic
1092640892 12:10507731-10507753 TACAGGTGTGTGCCACCACACGG + Intronic
1100873447 12:98937643-98937665 TACAGTACAGTGGAAGCCCAAGG - Intronic
1101763004 12:107674433-107674455 TACAGTAGGGTACAACCTGAAGG + Intergenic
1109770399 13:66963263-66963285 TATAGGAGTCTCCAACCCCAAGG - Intronic
1112316875 13:98370734-98370756 TACAGGAATGTGCAGCTCCAGGG + Intronic
1113205810 13:107914629-107914651 TACAGTAATATGAAACCTCAGGG + Intergenic
1114258786 14:21023428-21023450 TAGAGTAGTCTTCAACCCCTGGG - Intronic
1115749203 14:36471498-36471520 TAAAGTAGTGCACAAGCCCAGGG + Intergenic
1118983941 14:70737622-70737644 TACAGTTGTATACAACTCCAGGG - Intronic
1120136745 14:80878592-80878614 TGCAGTTGTGCCCAACCCCAGGG + Intronic
1121559786 14:94865840-94865862 AACAGCAGTGTGCAAACCCTAGG - Intergenic
1124701890 15:31921448-31921470 TACAGAAGAGTGCCACCACAGGG + Intergenic
1125601244 15:40916877-40916899 TACAGTAATGGGCTACCACAAGG + Intergenic
1133708589 16:8379335-8379357 ACCAGTAGTGTGCAACCCAGAGG + Intergenic
1134369749 16:13612126-13612148 TACAGTAGTGTTTATCCCTAAGG + Intergenic
1135935255 16:26774510-26774532 TACAGGTGTGTGCCACCACATGG + Intergenic
1140232848 16:73132142-73132164 TACAGTTGTGTGCCACCTCATGG - Intronic
1143049115 17:4108235-4108257 TGAAGTTGTGTGCAACCCAATGG + Intronic
1144563183 17:16338671-16338693 TACAGGTGTGTGCCACCCCCTGG - Intronic
1146288945 17:31594468-31594490 CACAGTGGTCTGCAAGCCCAGGG - Intergenic
1146500569 17:33360975-33360997 TAAAGTGGTCTGCAAACCCAGGG - Intronic
1149776102 17:59358436-59358458 TACACTGGTGTACAACACCAGGG - Intronic
1155066294 18:22272060-22272082 TCCAGAAGTTTACAACCCCATGG - Intergenic
1157089901 18:44625189-44625211 TAGAGTAGTGTGCCTGCCCATGG + Intergenic
1157411537 18:47466981-47467003 TACTGGAGGGTGCAATCCCAGGG - Intergenic
1157904591 18:51558293-51558315 TACAGGAGTCTGCAACCCCTGGG + Intergenic
1159927963 18:74285541-74285563 CACACTGGTGTGCCACCCCAGGG + Intronic
928318934 2:30268196-30268218 TACAGTAGTGTGCAACCCCAAGG + Intronic
928623288 2:33113307-33113329 GACAGTAGTCTACAAGCCCAAGG + Intronic
935321185 2:101890899-101890921 TACAGGTGTGTGCCACCACATGG + Intronic
937168219 2:119841259-119841281 TACAGTAATGTGTAAGCACAAGG - Intronic
937475132 2:122208517-122208539 CACAGTGGTGGCCAACCCCATGG - Intergenic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
944220157 2:197295562-197295584 GATAGTAGTCTGCAACCCCTGGG + Intronic
944227673 2:197364403-197364425 TACAGGTGTGAGCTACCCCAGGG - Intergenic
944479556 2:200143028-200143050 TAAAGTAGCGTCCAACACCAGGG - Intergenic
946290238 2:218738893-218738915 GACTGTATTGTCCAACCCCAAGG - Exonic
948722312 2:239908802-239908824 TGTCGTGGTGTGCAACCCCATGG - Intronic
1176159021 20:63639240-63639262 AACAGTGGGGTGCAGCCCCAGGG + Intergenic
1181358455 22:22316711-22316733 CACAGTCCTGTGCAACCTCATGG - Intergenic
950649085 3:14396138-14396160 TACAGCAGTGGCCAGCCCCATGG - Intergenic
958899005 3:99863374-99863396 TACAGGAGTCCCCAACCCCAGGG - Intronic
960458518 3:117903446-117903468 TACTGCTGTGTGCAGCCCCAGGG + Intergenic
972677852 4:41277511-41277533 TAACTTAGTGTGCCACCCCATGG + Intergenic
973618743 4:52706582-52706604 TACAAAAATATGCAACCCCATGG - Intergenic
975547058 4:75570675-75570697 TACAGGTGTGTGCCACCACATGG - Intergenic
978744283 4:112174302-112174324 TACAGCAGGGTGTCACCCCAGGG + Intronic
980421571 4:132566783-132566805 TGCAGAAGTGTGGAACCCCAGGG + Intergenic
981437180 4:144738343-144738365 AACAGTACTGTGCAATCCGATGG + Exonic
983892224 4:173041802-173041824 TACTTTAGTGGGCATCCCCAGGG - Intergenic
990194135 5:53294035-53294057 TACCCTAGTGTACCACCCCATGG - Intergenic
992791454 5:80217989-80218011 TACAGAAGTGTGGAACCCAGAGG - Intronic
995143034 5:108755329-108755351 TACAGAAGTGTTCAACTCCAAGG - Intronic
995978394 5:118071295-118071317 TACAGAATTGTGGAATCCCATGG - Intergenic
1000090966 5:157929512-157929534 TACAGGTGTGAGCCACCCCATGG - Intergenic
1002332693 5:178455393-178455415 CACAGCAGGGTGGAACCCCAGGG + Intronic
1002817456 6:693612-693634 CACTGGAGTGTGCATCCCCAGGG + Intergenic
1003468741 6:6408650-6408672 TACAGTCATGTGCTACTCCATGG + Intergenic
1007755900 6:44099334-44099356 AACAGTTGTGTGCTACTCCATGG + Intergenic
1008284626 6:49633039-49633061 TACGGTTGTGTGCAAACCCAAGG + Intronic
1018276352 6:162135833-162135855 TAAAGTGGTTTGCAATCCCAAGG - Intronic
1018836098 6:167485345-167485367 TACAGGAGTGTGCAGCCCCACGG + Intergenic
1022919019 7:34993923-34993945 TACAGTTGTGCGCCACCACACGG - Intronic
1024343659 7:48291639-48291661 TGAACTAGTGTGCAACCACAGGG - Intronic
1025579239 7:62690188-62690210 TTCAGTGGTGTGGAACCACAGGG + Intergenic
1030633337 7:111919528-111919550 TACAGTAGTTTTCAACCTGAAGG + Intronic
1040439482 8:47426111-47426133 TACAGGAGTGTGTGCCCCCATGG - Intronic
1041138890 8:54792330-54792352 TACAGTATTGTTCAAACCCATGG - Intergenic
1041801201 8:61802089-61802111 TGCAGAAGTTTCCAACCCCATGG - Intergenic
1047348569 8:124051794-124051816 TGTAGCCGTGTGCAACCCCAAGG - Intronic
1053516269 9:38733427-38733449 TTCAGCAGGCTGCAACCCCATGG + Intergenic
1056569370 9:87802378-87802400 AAGAGATGTGTGCAACCCCATGG - Intergenic
1057217334 9:93236292-93236314 CCCAGTAGTGTACACCCCCAGGG - Intronic
1061672643 9:132197769-132197791 TGCAGAGGTGTGCAATCCCATGG - Intronic
1189572876 X:42318385-42318407 CACAGTGGTGAGCAACTCCAGGG + Intergenic
1194845158 X:98797552-98797574 TACAGTATTGGGCAACTTCAGGG + Intergenic
1196564209 X:117186028-117186050 TACAGCCGTGAGCCACCCCATGG - Intergenic
1201239596 Y:11946061-11946083 GACAGGGGTTTGCAACCCCAGGG + Intergenic
1201322274 Y:12713102-12713124 TACAGTAGTGTTGAACTCCTGGG + Intronic