ID: 928319209

View in Genome Browser
Species Human (GRCh38)
Location 2:30269789-30269811
Sequence GACCTGGGTAGTGGTTTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 1, 2: 9, 3: 30, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928319209_928319214 8 Left 928319209 2:30269789-30269811 CCCATAAAACCACTACCCAGGTC 0: 1
1: 1
2: 9
3: 30
4: 207
Right 928319214 2:30269820-30269842 GAACGCTGTCACACCCCAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928319209 Original CRISPR GACCTGGGTAGTGGTTTTAT GGG (reversed) Intronic
903430295 1:23292832-23292854 GACATGGGAAGAGGTGTTATAGG + Intergenic
903858274 1:26350111-26350133 GACCGGACCAGTGGTTTTATAGG + Intronic
903939035 1:26916035-26916057 GAGGTGGATATTGGTTTTATGGG + Intronic
905548951 1:38820706-38820728 GACCTGGGTGGTGGTTACAAAGG + Intergenic
906886426 1:49653296-49653318 GACCTTGGATGTGGTTTTGTGGG - Intronic
907425451 1:54376355-54376377 GAAATGGGTAGTGGGTTTAGAGG - Intronic
907466299 1:54639978-54640000 GATCTGGGTGCTGGTTTCATGGG + Intergenic
908648695 1:66308426-66308448 GGTCTGGGTAGTGGTTACATAGG - Intronic
909080326 1:71103132-71103154 GATCTGGGTAGTGATTTCATAGG - Intergenic
909987089 1:82174169-82174191 GGCCTGGGCAGTGGATTTTTAGG + Intergenic
911135461 1:94434770-94434792 GATCTGGGTAGTGGTTAAAAGGG - Intronic
911563928 1:99440105-99440127 GATCTGGGTGGTGGTTACATAGG + Intergenic
911806741 1:102219636-102219658 GACCTGGGTAGTGGTTAAAAGGG + Intergenic
913155736 1:116096220-116096242 GACCTGGTTAGTGGTTCCCTGGG - Intergenic
913266009 1:117045262-117045284 GACCTAGGTTGTGGTTTCATGGG + Intergenic
913417961 1:118633309-118633331 GACCTGGCTAGTGCTGTTAGTGG + Intergenic
916332401 1:163631786-163631808 GATCTGTGTAGTGCTTTTAGTGG + Intergenic
916879403 1:169004639-169004661 GACTTGGGTTCTGGTTATATAGG + Intergenic
919365249 1:196651356-196651378 GACCTTGGTGGTGGTTTCACAGG + Intergenic
919963679 1:202499084-202499106 GATTTGGGTAGTGGTTATACTGG - Intronic
920053514 1:203177295-203177317 GACCTGGGTGGTGGTTACACAGG + Intergenic
921117753 1:212110404-212110426 GCCCTGGTTAGTGATTATATGGG + Intergenic
922316256 1:224445045-224445067 GACCTGGGTGATGGTTTCACGGG - Intronic
922850414 1:228728759-228728781 GATCTGAGTGGTGGTTTTATAGG - Intergenic
1063833514 10:9984633-9984655 GAGCTTGGTAGTTTTTTTATGGG + Intergenic
1065626670 10:27636502-27636524 GATCTGGATTGTGGTTGTATAGG - Intergenic
1065729262 10:28695724-28695746 CAAATAGGTAGTGGTTTTATTGG - Intergenic
1066538659 10:36420088-36420110 GACATGGATAGTGGCTTCATGGG + Intergenic
1066645610 10:37605390-37605412 GACATGGATAGTGGCTTAATGGG + Intergenic
1070034884 10:72712609-72712631 GAATTGTGTCGTGGTTTTATGGG + Intronic
1070074963 10:73126036-73126058 AATCTGGGTAGTGGGTGTATGGG - Intronic
1070717049 10:78730055-78730077 GACCTGGGTGGTGTTTACATAGG - Intergenic
1072534442 10:96350988-96351010 GATCTGGGTGTTGGTCTTATGGG - Intronic
1072951632 10:99851759-99851781 AACCTGGGTAGTAGGTTCATGGG - Exonic
1073536684 10:104282889-104282911 GACCTTTGGAATGGTTTTATGGG + Intronic
1074156034 10:110800574-110800596 GACTTTGGTGGTGGTTTTACGGG - Intronic
1074249310 10:111728455-111728477 TCTCTGGGTAGTGGATTTATGGG + Intergenic
1075425677 10:122340038-122340060 GATCTGGGTGCTGGTTATATGGG - Intergenic
1075518374 10:123128033-123128055 AATCTGGGTGCTGGTTTTATGGG + Intergenic
1075834966 10:125445314-125445336 GACCTTGGTAGTGGATGGATGGG - Intergenic
1076445019 10:130508545-130508567 GAACTGGCTTGTGGTTTTCTGGG + Intergenic
1076610086 10:131720063-131720085 TACCTGGGTGGTGGGTTGATAGG - Intergenic
1078263456 11:9733914-9733936 AACCTGGGTAGTATTTTCATGGG - Intronic
1079281130 11:19088208-19088230 GACCTGGGAAGTGCTTTGAGTGG - Intergenic
1079507259 11:21167349-21167371 GACTTGGGTACTGTTTTTTTTGG + Intronic
1079939268 11:26658026-26658048 GACCTGGGCAGAGATTTTTTTGG - Intronic
1083659644 11:64246185-64246207 GACCTGGGGAGTGGCATGATGGG + Intronic
1084496557 11:69508084-69508106 GATCTTGGTGGTGGTTTCATGGG - Intergenic
1085508973 11:77075774-77075796 GACCTGGGTGGTGGTTCCATGGG - Intronic
1086193994 11:84115288-84115310 TTCCTGGGTAGAGGTTTTATGGG - Intronic
1091508390 12:1096783-1096805 GACCTAGGTAGTGGTTATGAGGG - Intronic
1093823835 12:23656846-23656868 CACCTGGGTAGTGGGATTATAGG + Intronic
1097223729 12:57464894-57464916 GACTTGGGTAGGGGCTTTAGGGG - Intronic
1097238847 12:57559613-57559635 GATCTGTGTAGTGGTTACATGGG - Intronic
1097319379 12:58208568-58208590 GACCTGGCGAGTTGTTTTGTGGG - Intergenic
1097456430 12:59804110-59804132 TACCTGGGCAGTGGTGTTACAGG + Intergenic
1100098152 12:91068996-91069018 GACCTGGCTTGTAGTCTTATTGG - Intergenic
1100726371 12:97413270-97413292 GAACTGGGTGGTGGTTACATTGG + Intergenic
1102163648 12:110788961-110788983 GGCATGGGTATTTGTTTTATTGG - Intergenic
1104484258 12:129136203-129136225 GAGCTGAGTAGAGGTTATATAGG - Intronic
1105416561 13:20218365-20218387 GAGCTGGGTAGTGGGTATGTGGG + Intergenic
1106525932 13:30541425-30541447 TACCTGGATAGTGCTTTTCTGGG + Intronic
1108202054 13:48053887-48053909 GATCTAGGTGGTGGTTATATAGG - Intronic
1108301188 13:49077690-49077712 AACCTAGGTAATGGGTTTATAGG + Intronic
1109692523 13:65911329-65911351 AACCTAGGTGGTGGGTTTATAGG + Intergenic
1111774262 13:92639724-92639746 TACATGGGTAGGGGTTTTCTAGG + Intronic
1112075006 13:95903370-95903392 GACCAGGATAGTAGGTTTATGGG - Intronic
1115097780 14:29659089-29659111 GATCTGGGTAGAGGTTACATGGG - Intronic
1115299480 14:31867733-31867755 GACCTGGCTAGTGCTTTCAATGG - Intergenic
1115782392 14:36784063-36784085 GACCTGGGTAATCATTTTGTTGG - Intronic
1116400399 14:44499435-44499457 GAACTGGCTTTTGGTTTTATTGG - Intergenic
1117756892 14:58984020-58984042 TATCTGAGTAGTGGTTATATAGG + Intergenic
1120906711 14:89627087-89627109 CACATAGGTAGTGGTTTTACCGG - Intergenic
1122594900 14:102883534-102883556 GACCTGGGTGTTGGCTTCATGGG + Intronic
1124967511 15:34447210-34447232 TACCTGGGTAGTGGTTTTCTAGG + Intergenic
1125262650 15:37845227-37845249 GAACTGGGTAGTGGTCACATGGG + Intergenic
1127469813 15:59280891-59280913 GAACTGTGTAGTGGCTTTACTGG + Intronic
1127852871 15:62929403-62929425 GATCTCGGTCATGGTTTTATCGG - Intergenic
1129155853 15:73717311-73717333 GATCTGGGTAGTGGTTACATGGG - Intergenic
1130292428 15:82614322-82614344 GACCTGGGTAGTGGTTATGTGGG + Intronic
1130803502 15:87292364-87292386 GTGTTGTGTAGTGGTTTTATTGG + Intergenic
1131138407 15:89956968-89956990 GACTTGAGTAGTGGTTACATGGG + Intergenic
1132129625 15:99263973-99263995 GCCTTGAGCAGTGGTTTTATAGG + Intronic
1132191200 15:99862707-99862729 TACCTGGGTAGTGGTTTTCTAGG - Intergenic
1132257951 15:100394080-100394102 GACCTGGGTGGTGGTTACATGGG - Intergenic
1132653603 16:1032366-1032388 GACCTGGGGGGTGGTTCTACAGG - Intergenic
1134813260 16:17185375-17185397 TATCTGGGTGGAGGTTTTATTGG + Intronic
1135493698 16:22932939-22932961 TATCTGGGTAGTGGAATTATAGG - Intergenic
1137327032 16:47450375-47450397 GACCTGGTTAGTGCTTGGATGGG - Intronic
1137601427 16:49758974-49758996 GACCTGGGAAGTGGTTTCAATGG + Intronic
1138165756 16:54800179-54800201 GACCTGGCTTGTGGTTTCAAGGG + Intergenic
1139838329 16:69858214-69858236 CACCTGGTTTGTGGTTTTTTTGG + Intronic
1144694290 17:17291290-17291312 CTCCTGGGTAGTGGTATTACGGG + Intergenic
1145027590 17:19480167-19480189 GACCTGGGTAATGATTTTTTTGG - Intergenic
1146673488 17:34757709-34757731 GACCTGGGAGGTGGTTTCCTGGG - Intergenic
1149211097 17:54302156-54302178 GACCTGAGTAGTGGTTTCATGGG + Intergenic
1149234738 17:54577090-54577112 GACCTGGGTAAGGGTTACATAGG - Intergenic
1151664925 17:75540361-75540383 GACCTGGGCAGTGGGTTGATTGG + Intronic
1153170960 18:2315096-2315118 TCCCTGGGGAGTGGTGTTATGGG - Intergenic
1155136017 18:22993739-22993761 GACCTGGTTTGTATTTTTATTGG - Exonic
1158401149 18:57122471-57122493 TATCTGGGTGGTGGTTCTATAGG - Intergenic
1158420235 18:57286743-57286765 GTCCTGAGTAGTGGGATTATAGG - Intergenic
1164487370 19:28670304-28670326 GATCTGGGTGGTGGTTACATGGG + Intergenic
1164730918 19:30503825-30503847 CACCTGGGTAGTGGGATTTTGGG + Intronic
1167024676 19:46906575-46906597 GACTTGGGTAGTGGTTATATTGG - Intergenic
1168299538 19:55396366-55396388 GACCTGGGTATTGGTTACATAGG - Intronic
925402122 2:3582188-3582210 GACCTGTTTAGTGGCTTTTTGGG + Intergenic
925780835 2:7380274-7380296 GACTTTGGTAGTGGTAGTATTGG + Intergenic
926187855 2:10705637-10705659 GACCTGGGTGGTGGCTTCATGGG + Intergenic
927831706 2:26357093-26357115 GAGCTGGGTGGTGGTTACATGGG - Intronic
928035989 2:27823724-27823746 AACCAGGGTAGTGATTTTCTGGG - Intronic
928133755 2:28672550-28672572 TACCTGGGTAATGGGTTGATAGG + Intergenic
928182306 2:29077464-29077486 GACCTAGGTGGTAGTTATATGGG + Intergenic
928319209 2:30269789-30269811 GACCTGGGTAGTGGTTTTATGGG - Intronic
928997075 2:37303899-37303921 GACCTGAGTGGTGGTTATGTGGG - Intronic
930733591 2:54752381-54752403 GATCTGGGTAGTAGTTATATGGG - Intronic
930831193 2:55745097-55745119 CACCTGGGTGGTGGTTTTCATGG - Intergenic
931264486 2:60648414-60648436 TACCTAGTAAGTGGTTTTATAGG - Intergenic
931554608 2:63488583-63488605 GTCCTGGATGGTGATTTTATGGG + Intronic
931573463 2:63695713-63695735 GACCTGGGTGCTGGTTACATGGG - Intronic
932953392 2:76320629-76320651 GACCGGGATATTGGTTATATAGG - Intergenic
935004157 2:99054448-99054470 GACCAGGGTAGTGATTGTTTTGG + Intronic
936339864 2:111621600-111621622 GATCTTGGTGGTGGTTTCATGGG + Intergenic
938455985 2:131464650-131464672 GAACTGGGTATTGGTTTTTGGGG + Intergenic
938685814 2:133736677-133736699 GATCTGAGTGGCGGTTTTATGGG + Intergenic
939335055 2:140815618-140815640 GATCTGGGCACTGGTTATATAGG + Intronic
940079212 2:149780851-149780873 GACCTGTGTAATGGTTTAAATGG - Intergenic
941415006 2:165209045-165209067 AATCTGGGTAGTAGTTATATAGG + Intergenic
943829132 2:192436543-192436565 GACCTGTGTAGTAATTTTAGGGG + Intergenic
945794511 2:214345619-214345641 GACTTGAGTAGTGGTTTCAGGGG - Intronic
945966014 2:216187607-216187629 TACCTGTGTAGTTGTTTCATGGG + Intronic
947062300 2:226180589-226180611 GTACTGGGAAATGGTTTTATAGG - Intergenic
947161030 2:227214598-227214620 GACCTGTGAAGTGTTTTAATAGG - Intronic
1169277221 20:4241982-4242004 GACCTGGGTAGTGATGACATTGG - Intronic
1169466142 20:5841318-5841340 GATCTAGGTAGTGGTTATGTGGG - Intronic
1170231925 20:14058117-14058139 GACTTGGGTGGTGGTTACATGGG + Intronic
1170584814 20:17726618-17726640 GATCTGGGTAGTGGGTACATAGG - Intronic
1170801525 20:19594245-19594267 GACCTGTGTAGGGGGTTGATAGG - Intronic
1171380276 20:24729394-24729416 CACATGGGTGGTGGTTATATGGG + Intergenic
1171428909 20:25066584-25066606 GACCTGGGAAGTGGCTTGAGAGG + Intergenic
1178691001 21:34749843-34749865 GATCTGGGTAGTGGTTACATGGG - Intergenic
1178830879 21:36055446-36055468 GACCTGGCTAGTGCTTTTGGTGG + Intronic
1178912376 21:36685806-36685828 GATCTGGGTGGTGGTTATATGGG - Intergenic
1181851720 22:25754475-25754497 GATCTGAGTAGTGGTTCCATGGG - Intronic
1184605752 22:45573818-45573840 GACCTGGGTGGTGATTATAAAGG + Intronic
949625216 3:5858123-5858145 GATCTGGGTGGTGGTTATATAGG + Intergenic
949845335 3:8364390-8364412 GACCTGGATAATGGTTTACTGGG - Intergenic
951843487 3:27060519-27060541 GACCTGGGCAGTGGTTTCATGGG + Intergenic
952003485 3:28813209-28813231 GACCTGGGTGGTTATTTTGTGGG - Intergenic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
953481038 3:43252470-43252492 GACCTGGGTGGTGATTATACAGG - Intergenic
953648843 3:44781198-44781220 GATCTGGTTAGTGGTTATACAGG - Intronic
956044441 3:65180339-65180361 GATCTTGGTTGTGGTTATATAGG + Intergenic
956729158 3:72180805-72180827 GAGCTGGGTGGTGGTTGCATAGG + Intergenic
959666269 3:108925695-108925717 GACCTGTGTAGTGGTATCAGTGG + Intronic
959854959 3:111141917-111141939 TTCCTCTGTAGTGGTTTTATTGG + Intronic
960250985 3:115453196-115453218 GAACTGGGTAAGTGTTTTATGGG + Intergenic
960646520 3:119890632-119890654 GACCAGGGTAGTGGTTATATGGG + Intronic
961023974 3:123535921-123535943 GACCTGGGTAGTGATGGGATTGG - Intronic
961527181 3:127512483-127512505 GACCTGGTTGGTGGCTTCATGGG + Intergenic
962221125 3:133565347-133565369 GATCTGGGAAGTTGTTTTTTGGG - Intergenic
962228843 3:133641883-133641905 GACCTGGGTGGTGGACTTAAGGG - Intronic
964260574 3:154830966-154830988 GACCTGGTGAGTGGTTTTGGTGG + Intergenic
965714232 3:171585681-171585703 GACCTGGGTAATGGTTTTATGGG + Intergenic
967841804 3:194010898-194010920 GACCTGGGTTGTGGTCTTCTTGG - Intergenic
970262348 4:14241074-14241096 GACCTAGGTAATGGGTTGATAGG + Intergenic
971915575 4:32866363-32866385 GAAGTGGGGAGTGGTTTTGTGGG + Intergenic
972676880 4:41268715-41268737 AAACTGGGTGGTGGGTTTATGGG - Intergenic
973876034 4:55219560-55219582 GAGCAGGGTTGTGGTTGTATTGG + Intergenic
975540699 4:75507971-75507993 GATCTGGGTAGTGGTTACAAAGG + Intronic
976354858 4:84105291-84105313 GAACTGGGAAGTGGTTTTAAAGG + Intergenic
976425394 4:84897213-84897235 AGCCTGGGCAGTGTTTTTATGGG + Intronic
977131232 4:93240876-93240898 GACCTGGTTAGTGGTTAAATTGG - Intronic
977790881 4:101101719-101101741 GATCTGGGTAGTGGTTTCATGGG - Intronic
979584630 4:122401568-122401590 GACCTGTGTAGTGTTGTTAGTGG + Intronic
979945309 4:126823649-126823671 GAAGTGGGTGGTGGTTTTATGGG + Intergenic
981206810 4:142051469-142051491 GACTTGGGTGGTGGTTTCATCGG + Intronic
982614330 4:157622032-157622054 GACCTGGGTGGTGGTTACAAAGG - Intergenic
983186244 4:164704381-164704403 GACATGGGTGGTGGATATATGGG + Intergenic
986545262 5:8890366-8890388 GATCCAGGTACTGGTTTTATAGG - Intergenic
988312377 5:29577489-29577511 TACCTGGGTGATGGATTTATTGG - Intergenic
988936541 5:36089012-36089034 GACTTCGGTGGTGGTTTTACAGG - Intergenic
992171994 5:74112000-74112022 GATCTGGGTGGTGGTTGTATGGG + Intergenic
993648490 5:90488870-90488892 GAAGTGGGAAGTGGTTTTATAGG + Intronic
995611418 5:113914030-113914052 GACCTGGGTAGGGGTTTCCAGGG - Intergenic
996684890 5:126269214-126269236 GATCAGGGTAGTGTTGTTATAGG - Intergenic
996967601 5:129323185-129323207 GACGTGGGTGTTGCTTTTATTGG + Intergenic
998042496 5:138960961-138960983 GATCTGGGTGGTGGTTACATGGG + Intronic
1000422198 5:161051000-161051022 GATCTGGGTAATGGTTACATGGG + Intergenic
1003623144 6:7720098-7720120 TACCTGGGTGGTGGTTATACAGG - Intergenic
1004334511 6:14752172-14752194 GACCTGTGTAGTGATTTTGATGG - Intergenic
1004923223 6:20395942-20395964 GACCTGGGTGGTGGTTACAAAGG + Intergenic
1005435756 6:25810194-25810216 GACCTGGGCAATGATTTTTTTGG + Intronic
1007427152 6:41754766-41754788 GATCTGTGTACTGGTTTTGTGGG + Intergenic
1008178289 6:48294961-48294983 CACCTGGGTGGTGGTTATATGGG - Intergenic
1008306350 6:49905885-49905907 GACCTGGCTGCTGGTATTATAGG + Intergenic
1008310320 6:49961710-49961732 GACTTGGGTAGTGTTTACATAGG - Intronic
1008423171 6:51326606-51326628 GACCTGAGTAGTGGTTATATTGG + Intergenic
1008532347 6:52474926-52474948 AACCTGGATGGTGGTTATATGGG + Intronic
1011319758 6:86078379-86078401 GACCTGTGTAGTGGTGTCAGTGG + Intergenic
1011404870 6:87008823-87008845 GATCTGGGTAGTGGTTTGCAGGG - Intronic
1013386032 6:109632091-109632113 GACCTGGTTGGTGGTTACATGGG + Intronic
1014335036 6:120122713-120122735 GTCCTGTGTAGTGGGTTCATTGG - Intergenic
1014859830 6:126451974-126451996 GACCTGGGTGGGGGGTCTATTGG - Intergenic
1015944951 6:138490068-138490090 GACCTAGGTAATGGTTATACAGG + Intronic
1021279290 7:18697393-18697415 GCTCTGGGTGATGGTTTTATGGG - Intronic
1023696090 7:42848675-42848697 GACCTGGGCAATGGTTTTTTTGG + Intergenic
1024272840 7:47655436-47655458 GACCTGGGAAGTGGTTACATGGG + Intronic
1024918541 7:54531625-54531647 GACCTGGGAACTGGTTCTATGGG - Intergenic
1027341321 7:77211112-77211134 GACCTGGGTGGTGGTTACTTGGG - Intronic
1033803430 7:144927426-144927448 GATCTGGATAGTGGTTACATGGG - Intergenic
1034727156 7:153347406-153347428 GACTGGGGTAGTGGGTTTTTTGG + Intergenic
1035878107 8:3213393-3213415 CACCTAGGTGGTGGTTTCATGGG - Intronic
1037234955 8:16708988-16709010 GACCTGGATACTGGTATTAAAGG - Intergenic
1038655067 8:29443297-29443319 TACCTGGGTGGTGGTTAAATGGG + Intergenic
1039075122 8:33683304-33683326 GAAATGGATAGTGGTTTAATGGG + Intergenic
1041584724 8:59502151-59502173 CAACTGTGTAGTTGTTTTATAGG - Intergenic
1042734854 8:71976925-71976947 GGCCTGGAAAGTGCTTTTATTGG + Intronic
1047852522 8:128873865-128873887 GTAGTGAGTAGTGGTTTTATTGG + Intergenic
1052610238 9:30762256-30762278 GACCTCTGAATTGGTTTTATAGG + Intergenic
1055762349 9:79622374-79622396 GAACTGGGTAGGGGCCTTATAGG - Intronic
1056082303 9:83108144-83108166 GATCTGGGTAGTGTTTACATGGG + Intergenic
1056399888 9:86216327-86216349 GCCCTGGGTAGTGATTCCATAGG + Intergenic
1057838523 9:98466398-98466420 GACCTGGGTGGTAGTTACATGGG + Intronic
1059633028 9:116145060-116145082 GACCTGGTTCCTGGTCTTATGGG - Intergenic
1061138424 9:128750215-128750237 TCTCTGGGTAGTGGGTTTATGGG + Intronic
1186661398 X:11671105-11671127 GATCGTGGTAGTGGTTTCATGGG - Intergenic
1187499793 X:19830301-19830323 GATCTGGGTGGTGGTTATAGAGG + Intronic
1188502491 X:30843233-30843255 CATCTGTGTAGTGGTTTTCTTGG - Intronic
1189235341 X:39482659-39482681 GATCTGGGTGGTGGTTACATGGG + Intergenic
1190049563 X:47139731-47139753 GACCTGAGTGCTGGTTATATGGG + Intergenic
1191082400 X:56526746-56526768 ATCCTGGGTAGTGGAATTATAGG + Intergenic
1191212319 X:57899489-57899511 CATCTGAGTAGTGGTTTTATAGG + Intergenic
1191590381 X:62876674-62876696 TACCTAGGTAGTGGGTTGATAGG + Intergenic
1193591870 X:83398338-83398360 GATCTGTCTAGTGGTTTTAGTGG - Intergenic
1194450462 X:94039643-94039665 AATCTGGGTAATGGTTTCATGGG - Intergenic
1195034649 X:100961356-100961378 GACCTGGGTGGTGGTTACAAGGG + Intergenic
1195488284 X:105435951-105435973 TACCTGGGTAATGGGTTGATAGG + Intronic
1196651518 X:118172992-118173014 GATGTGGGTAGTGGTTACATGGG - Intergenic
1197063200 X:122207352-122207374 GACATGAGTTGTGGTTATATGGG - Intergenic
1198238707 X:134762368-134762390 GACCTGGGTGATGGTTACATGGG - Intronic
1198799718 X:140436375-140436397 GCCCTGGGTGCTGGTTTCATAGG + Intergenic
1200313725 X:155107988-155108010 GATCTGGGTTGTGGTTGCATAGG - Intronic
1200388808 X:155921329-155921351 GATCTGGGTGGTGGTTACATGGG - Intronic
1200681051 Y:6211859-6211881 GACCTGGGTGGTGGGTATAATGG + Intergenic
1201629522 Y:16054756-16054778 GACTTTGGTAGTGGTTCTGTGGG - Intergenic
1202299320 Y:23394926-23394948 GATTTGGGTAGTGGTTATACTGG - Intergenic
1202571489 Y:26275672-26275694 GATTTGGGTAGTGGTTATACTGG + Intergenic