ID: 928319887

View in Genome Browser
Species Human (GRCh38)
Location 2:30274592-30274614
Sequence GCTTCATTTTGACCTGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928319887_928319893 24 Left 928319887 2:30274592-30274614 CCTGTCCCAGGTCAAAATGAAGC 0: 1
1: 0
2: 0
3: 17
4: 122
Right 928319893 2:30274639-30274661 CAGAACATTCTTTCCAAACCAGG 0: 1
1: 0
2: 1
3: 15
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928319887 Original CRISPR GCTTCATTTTGACCTGGGAC AGG (reversed) Intronic
903029514 1:20452832-20452854 GCTTGATTTGGAACTGGGTCTGG + Intergenic
904597634 1:31656797-31656819 GTTTCTTTTTGACCAGGTACAGG + Intronic
906538270 1:46564413-46564435 GGTCCATTTTCACCTGGGTCAGG + Intronic
907548793 1:55286734-55286756 GCTTGATTTTGACATATGACTGG + Intergenic
907816762 1:57925927-57925949 ACTTCCTTTTGACCTTGGACAGG + Intronic
907860059 1:58344378-58344400 ACTTCATTTTGAACTGTGCCAGG + Intronic
908188449 1:61675601-61675623 GCTACATTTTTAGCAGGGACGGG + Intergenic
911194559 1:94980549-94980571 TCTTCAGTTTGAGTTGGGACTGG + Exonic
911960849 1:104300962-104300984 GCTTTATTTTCAGCTGTGACAGG - Intergenic
914482996 1:148083065-148083087 GCTTCAGTCTGACCAGGGAGAGG - Intergenic
916832484 1:168507268-168507290 CCTTCATTTGGACCTGAGTCCGG - Intergenic
920136671 1:203775042-203775064 CCTTCCTTTTGACCTCTGACTGG - Exonic
1063135191 10:3210156-3210178 GCTTGATTTTGAGCTGGAACAGG - Intergenic
1066058277 10:31701067-31701089 CCTTCTCTTTGACCTGGGGCAGG + Intergenic
1067221444 10:44347032-44347054 GCTTCATGCTGACCTGGGAGGGG - Intergenic
1070531501 10:77341524-77341546 GCTTTCTCTTGACCTGGGAGAGG - Intronic
1070874607 10:79791606-79791628 GTTTCATTTTGACCAGAGACTGG - Intergenic
1071641531 10:87313769-87313791 GTTTCATTTTGACCAGAGACTGG - Intergenic
1075987846 10:126803530-126803552 GCTTCATCTGGGCCTGGGAGTGG - Intergenic
1078849226 11:15149043-15149065 GGTTCCTTGTGGCCTGGGACTGG + Intronic
1079106629 11:17576268-17576290 GCCTCATTTGGACCGGGGAAGGG - Intronic
1080397225 11:31901417-31901439 TATGCATTTTGACCTGGGAGGGG + Intronic
1086563716 11:88199466-88199488 GCTCTATTTTGACCCAGGACTGG + Intergenic
1087430430 11:98046634-98046656 GATTCATTTTGTCCAGGAACTGG - Intergenic
1088475744 11:110237214-110237236 GATTCACTTTGACATTGGACAGG - Intronic
1090704680 11:129325613-129325635 GCATCGTTTTAACCTGGAACTGG - Intergenic
1091443018 12:526392-526414 TCTTCTTTCTGGCCTGGGACAGG - Intronic
1097026883 12:56063305-56063327 TCTTCTTTTTCACCTGGAACAGG - Intergenic
1097318488 12:58199544-58199566 GCTTCATTTAGAGGTGAGACTGG - Intergenic
1100439801 12:94606327-94606349 GCTTCTTTTTGCCTTGGGAAAGG + Intronic
1101013714 12:100477448-100477470 GGTTCATTGAGACCTGGGAAAGG - Intronic
1104628445 12:130379199-130379221 ACTTCATTTGTACCTGGTACTGG + Intergenic
1110158356 13:72345248-72345270 GCTTCCTTTTGGCCTGAGAGTGG + Intergenic
1118602675 14:67481670-67481692 GCTTAACTTTGAGCTAGGACAGG + Intronic
1121522254 14:94594118-94594140 GCTTCCCTGTGACCTTGGACTGG - Intronic
1121572169 14:94954611-94954633 GATTCATGGTGACCTGGGGCTGG + Intergenic
1123666256 15:22611220-22611242 GATTGTTTTTGACCTGGGCCTGG + Intergenic
1124320077 15:28705626-28705648 GATTGTTTTTGACCTGGGCCTGG + Exonic
1124482435 15:30089791-30089813 GATTGTTTTTGACCTGGGCCTGG - Exonic
1124488894 15:30141893-30141915 GATTCTTTTTGACCTGGGCCTGG - Exonic
1124521143 15:30407418-30407440 GATTGTTTTTGACCTGGGACTGG + Exonic
1124537519 15:30558802-30558824 GATTGTTTTTGACCTGGGACTGG - Exonic
1124543978 15:30610857-30610879 GATTCTTTTTGACCTGGGCCTGG - Exonic
1124754636 15:32396430-32396452 GATTCTTTTTGACCTGGGCCTGG + Exonic
1124761137 15:32448785-32448807 GATTGTTTTTGACCTGGGACTGG + Exonic
1124777497 15:32600278-32600300 GATTGTTTTTGACCTGGGACTGG - Exonic
1128111569 15:65079496-65079518 TCATCATTTTAATCTGGGACAGG - Intergenic
1131754156 15:95542086-95542108 TTTTCATTTTGTTCTGGGACAGG + Intergenic
1135651048 16:24206934-24206956 GCTTCATTTTGTTTTGAGACAGG + Intronic
1139301654 16:65950001-65950023 GCTTCTTTTAGACCTGGGGTGGG - Intergenic
1141398031 16:83721980-83722002 ACTTCATTCTGAACTGGGAGTGG + Intronic
1142828253 17:2528247-2528269 CCTCCATTTTGCCCTTGGACTGG - Intergenic
1144263515 17:13546196-13546218 GATTCATTTTTTCCTGGGAGTGG - Intronic
1150720980 17:67614186-67614208 ACTTCATTTTGATCTGGGCTGGG - Intronic
1151399054 17:73843705-73843727 GCTGGATTCTGAGCTGGGACTGG + Intergenic
1152319833 17:79602514-79602536 GCTCCTTATAGACCTGGGACGGG - Intergenic
1152415687 17:80160244-80160266 ATTTCATTTTGTCATGGGACTGG + Intergenic
1152415700 17:80160325-80160347 ATTTCATTTTGTCATGGGACGGG + Intergenic
1157502425 18:48200932-48200954 GCTTCATCCTGACCAGGGTCAGG - Intronic
1158214405 18:55084564-55084586 TCTTCATTATGTCCTAGGACTGG + Intergenic
1167242934 19:48355874-48355896 GCATCAGTTTGACCTCGGAGGGG + Intronic
928319887 2:30274592-30274614 GCTTCATTTTGACCTGGGACAGG - Intronic
931874106 2:66493350-66493372 GCTTCATGTTAAACTGGGAGAGG - Intronic
932644948 2:73490430-73490452 GCTACAATTTGCCCTGGTACTGG - Exonic
933982036 2:87558378-87558400 GCTTAATTTTGGCCTGGGCGTGG - Intergenic
936311802 2:111392434-111392456 GCTTAATTTTGGCCTGGGCGTGG + Intergenic
936941772 2:117891054-117891076 TGTTCAGCTTGACCTGGGACGGG + Intergenic
938386065 2:130868243-130868265 ACTGCATCTGGACCTGGGACTGG + Intronic
940234368 2:151494068-151494090 GTTTGTTTTTAACCTGGGACAGG + Intronic
940318642 2:152350598-152350620 GCTATAGGTTGACCTGGGACAGG + Intronic
943025450 2:182622663-182622685 GCTTCCTACTGACCTGGGAGTGG - Intergenic
947487922 2:230569555-230569577 TTTTCATTTTGACCTGTGAGCGG - Intergenic
947588334 2:231370569-231370591 GCTTCTGTTTGACCTGGGGGTGG - Intronic
948201086 2:236130240-236130262 TTTTCATTTTGGCCTGGCACAGG + Exonic
1169310415 20:4533603-4533625 GTTTCATTTTTCCCTGGGTCTGG - Intergenic
1170098081 20:12669029-12669051 TCTTCATTTAGCCCTGGCACTGG + Intergenic
1170668269 20:18405933-18405955 GCTTTATTTTCAGCTGTGACAGG - Intronic
1178767870 21:35471407-35471429 GCTTGATATTGACCTGGGAAAGG + Intronic
1179616123 21:42584419-42584441 GCTTCATGGTGACCTGCGACTGG - Intergenic
1179988426 21:44933325-44933347 GCCACATTTTCACCTGGGCCTGG - Intronic
1183253264 22:36744800-36744822 TCTTCCTTTTACCCTGGGACAGG + Intergenic
1184622472 22:45691959-45691981 GCTCCATCTTGACCCTGGACAGG + Intronic
1184851604 22:47124473-47124495 GCCTCTTCTTGACCTGGGCCTGG + Intronic
954150031 3:48652691-48652713 GCTTGATTTTGACCGGGGGTGGG + Intronic
955784159 3:62518668-62518690 GCTTCTTCCTTACCTGGGACAGG + Intronic
955852157 3:63232287-63232309 GAATCATTTGAACCTGGGACGGG - Intronic
957013011 3:75029436-75029458 CCTTCATTTTGGCCTGTGAGAGG - Intergenic
957217080 3:77334486-77334508 GCTTCATCTTATCCTGGGCCTGG - Intronic
963418151 3:145025716-145025738 GTTTCTTTTAGTCCTGGGACTGG + Intergenic
965812288 3:172603663-172603685 GTTCCATTTGGTCCTGGGACAGG + Intergenic
969291622 4:6243742-6243764 GGTTCACTTTGCCCTGGGACTGG - Intergenic
970010110 4:11449089-11449111 GCTTCCTGTTGACCAAGGACAGG + Intergenic
974513970 4:62883639-62883661 GATTCATATTGTCCTGGGAAAGG + Intergenic
981747612 4:148066717-148066739 TCTTCTGTGTGACCTGGGACAGG + Intronic
983384962 4:167049545-167049567 GATTTATTTTGACCTGAGAAAGG + Intronic
986241181 5:5961352-5961374 GCTTCTCCTTGACCTGGGACTGG - Intergenic
988610615 5:32721142-32721164 GCTCCAGTTTGAACTGGAACTGG + Intronic
992267533 5:75033599-75033621 GTTTTATTTTGATTTGGGACAGG - Intergenic
993048550 5:82897053-82897075 GGTACATTTTGGCCTGGGGCAGG - Intergenic
998129457 5:139643993-139644015 GAGTCATTTTGTTCTGGGACTGG + Intergenic
998157437 5:139795064-139795086 GCTTCCCCTTGACCTGGCACAGG + Intergenic
999253379 5:150195897-150195919 ACCTCATTTTGTCCTGAGACAGG + Intronic
999527101 5:152418896-152418918 TTTTTATTTTAACCTGGGACAGG - Intronic
1001876509 5:175206398-175206420 GTTTTATTTTTACCGGGGACTGG - Intergenic
1003172442 6:3730398-3730420 GCTCCATTTTCACCTGGCACAGG - Intronic
1003567089 6:7230817-7230839 GCTTCACTTGGACCAGGGCCAGG - Exonic
1006908403 6:37548210-37548232 GCTTCAAGTTGCCCTGGGATGGG + Intergenic
1011329953 6:86193069-86193091 TCTTCATTTCTCCCTGGGACTGG - Intergenic
1016465962 6:144325699-144325721 GCCTCATTTTGAAATGGGAGGGG + Intronic
1018022514 6:159775160-159775182 GCTACATTTTCAGCTGGGAAAGG - Exonic
1032254612 7:130287138-130287160 GCTGCATACTGACCTGGGGCAGG - Intronic
1035904113 8:3490758-3490780 GCCTGCCTTTGACCTGGGACAGG - Intronic
1036949367 8:13126299-13126321 GTTTCATTTCAACCTGGGGCAGG + Intronic
1038023719 8:23571250-23571272 GCTTCATTCCGACCTGGGGTGGG + Intronic
1038502612 8:28058517-28058539 GCTGCATTTTTGACTGGGACAGG - Intronic
1038975939 8:32696073-32696095 TCTTCATTTCCACCTGGGGCTGG - Intronic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1045544948 8:103120152-103120174 GCTGAACTTGGACCTGGGACAGG + Intergenic
1046268962 8:111867806-111867828 GCTACATTTAGACCTGGACCTGG - Intergenic
1049992325 9:1001698-1001720 GCTTACATGTGACCTGGGACAGG + Intergenic
1050913969 9:11108166-11108188 GCTTCCCTCTGACCTGGGATAGG - Intergenic
1052290860 9:26838771-26838793 GCTTCATTTTGAATTGGGTAGGG + Intergenic
1052792402 9:32887916-32887938 GTTTCATTTTGTCTTGGGATTGG - Intergenic
1056657804 9:88523294-88523316 GCTTCTTTATGACCTGGGTGAGG + Intergenic
1056890694 9:90488950-90488972 CCTTCCTTCTGACCTGGGCCTGG - Intergenic
1059164409 9:112064576-112064598 GCTTCATTTTGGCCGGGTGCGGG + Intronic
1059294575 9:113258810-113258832 GTTCCATTTGGTCCTGGGACAGG - Exonic
1059421917 9:114197523-114197545 GCTGCTTTATGAGCTGGGACCGG - Intronic
1060964301 9:127703990-127704012 TCTTCATTTCGCCCTGGGAGGGG - Intronic
1061189621 9:129074631-129074653 GCTTGATGCTGGCCTGGGACTGG - Intergenic
1062227922 9:135464270-135464292 GCATCATCTTGACCTTGGTCTGG - Intergenic
1062330918 9:136044607-136044629 GCTGCCTTGTGGCCTGGGACGGG - Intronic
1186628360 X:11319873-11319895 GCTTCATTTTGAAATTGGCCAGG + Intronic
1187226586 X:17379174-17379196 GCTTCCTGTTGCCCTGAGACAGG + Intronic
1187720839 X:22149302-22149324 GCTTCACTCTGCCCTGGAACAGG - Intronic
1189917227 X:45867737-45867759 GCTTAATTTTGTCCTTGGAGTGG - Intergenic
1191937622 X:66442032-66442054 GCTTTATTCTGACCTGTGAGGGG + Intergenic
1192211531 X:69130900-69130922 GCATCAGTTTAACCTGGGAAGGG - Intergenic
1193859061 X:86641182-86641204 GATTCATATTGTCCTGGGATTGG - Intronic
1200038907 X:153351819-153351841 GCTTGATTTTGTCCTAGAACTGG + Exonic