ID: 928321388

View in Genome Browser
Species Human (GRCh38)
Location 2:30285211-30285233
Sequence GGGATATTTACACCATTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928321384_928321388 5 Left 928321384 2:30285183-30285205 CCAATCTGACAATCTCTGCCTTT 0: 13
1: 94
2: 271
3: 517
4: 1734
Right 928321388 2:30285211-30285233 GGGATATTTACACCATTTGAAGG 0: 1
1: 0
2: 2
3: 11
4: 132
928321383_928321388 21 Left 928321383 2:30285167-30285189 CCTTTTTAAAAAAACTCCAATCT 0: 1
1: 0
2: 7
3: 61
4: 700
Right 928321388 2:30285211-30285233 GGGATATTTACACCATTTGAAGG 0: 1
1: 0
2: 2
3: 11
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928321388 Original CRISPR GGGATATTTACACCATTTGA AGG Intronic
907539677 1:55202192-55202214 AGTATATTTACACCATTCCAAGG + Intronic
908103627 1:60816861-60816883 GGGGCATTTAGACCATTTGATGG + Intergenic
908467495 1:64412201-64412223 GGTATATTTCCACCATATTAGGG + Intergenic
913804431 1:122768203-122768225 TGGATATTTTCACCATTTAGAGG + Intergenic
915747149 1:158171646-158171668 GGTGTATTTTTACCATTTGAGGG + Intergenic
917265457 1:173216291-173216313 GGGATCTTTACACCATCAGGGGG + Intergenic
917519237 1:175734353-175734375 GAGCTATTTACCCCATTTGATGG + Intronic
918175548 1:182041126-182041148 GGGAAGTTCACTCCATTTGAAGG - Intergenic
922354067 1:224759858-224759880 GGGATGGTTTCACCATGTGATGG + Intergenic
923936974 1:238772896-238772918 GGGATTTTTCCAACATCTGAAGG - Intergenic
1065300717 10:24318883-24318905 GGGATATTTTAACTTTTTGAGGG - Intronic
1067443052 10:46322482-46322504 AGTATATTTTCACCACTTGATGG - Intronic
1069806411 10:71127868-71127890 GTGTGATTTACACCCTTTGAGGG + Intergenic
1070892372 10:79951350-79951372 GGGATTTTTTCCCCCTTTGAAGG + Intronic
1071226232 10:83531537-83531559 GGGATAGCTACATCATTTAATGG + Intergenic
1071483962 10:86085697-86085719 GGGATATGGAGACCATTGGATGG - Intronic
1071843323 10:89495540-89495562 GGGATATTTTCAGTTTTTGATGG - Intronic
1074015300 10:109528409-109528431 GGGATATGTTCACCATCTGCAGG - Intergenic
1075339025 10:121630712-121630734 GTGATAAGTACACCATTCGATGG + Intergenic
1076202775 10:128571532-128571554 GGGATGTTTTCACCATTTGGGGG + Intergenic
1078082940 11:8217289-8217311 GGGATTTTTAAATCATTTTAAGG + Intergenic
1082002528 11:47400937-47400959 ATGCTATTTACACCATCTGAAGG + Intergenic
1086788627 11:91005786-91005808 GGAATATTTAGAACATTTAATGG - Intergenic
1088117867 11:106333022-106333044 GCAATATTTACAGCATTTGGTGG - Intergenic
1088564363 11:111152297-111152319 AGGATATTTCCACCATTTTGGGG - Intergenic
1090232776 11:125120790-125120812 GGGAAATTTTGACCAGTTGAAGG - Intergenic
1090597014 11:128330542-128330564 GGGCTATTTACAGCATGTGTGGG - Intergenic
1092099471 12:5871269-5871291 GGGATATTTATATTTTTTGAAGG + Intronic
1094404990 12:30107925-30107947 GGCATATTTACAGCATCTAATGG + Intergenic
1095067440 12:37795761-37795783 GGGATATTTGCAGCATTTTTAGG + Intergenic
1097649688 12:62281677-62281699 GGGCTATCTACACAATTTTATGG - Intronic
1100784612 12:98065774-98065796 GGGATATGGACATCTTTTGAGGG - Intergenic
1102136452 12:110580288-110580310 GGGATATTTACAAGAATTGGGGG - Intronic
1104136265 12:125941974-125941996 AGGATTTTTACATCCTTTGAAGG + Intergenic
1104162945 12:126198251-126198273 GGAACATTTACACCATTTCTTGG + Intergenic
1104215718 12:126731209-126731231 GTGATAATGACATCATTTGAAGG - Intergenic
1106001585 13:25728532-25728554 GGGATATTTGATCCATGTGATGG + Intronic
1106930904 13:34663424-34663446 AGGATATTTTCAACATATGATGG + Intergenic
1112896770 13:104308627-104308649 GGGAGATTTATACCATATAATGG + Intergenic
1113490126 13:110684782-110684804 GGAATGTTTCCACCATTTAAGGG - Intronic
1115603435 14:34977503-34977525 TGAATTTTTATACCATTTGATGG - Intergenic
1120849140 14:89153263-89153285 GGCATCTTGACACCATTTAATGG + Intronic
1125706258 15:41739216-41739238 GGGATCTTTACTTCATTTGTTGG + Intronic
1127937975 15:63661727-63661749 TGGATATCTACACAATTTCAAGG + Intronic
1128373645 15:67059676-67059698 AGGAGATTAACACCATTTGTGGG - Intergenic
1130913947 15:88290463-88290485 GGGATCCTTCCATCATTTGAAGG - Intergenic
1139275002 16:65719418-65719440 GAGATCTTTACACAATTAGAGGG + Intergenic
1145610381 17:25565785-25565807 GGGATAATTGCACTCTTTGAGGG + Intergenic
1146465331 17:33081812-33081834 GCCACATTTCCACCATTTGAAGG - Intronic
1147228520 17:38999998-39000020 GGGTCAATTACACCATCTGAGGG + Intergenic
1151110537 17:71671816-71671838 GGGATAATAATACCTTTTGATGG - Intergenic
1151160832 17:72164229-72164251 GGGATATTGTCCCCATTTTATGG + Intergenic
1153161817 18:2214891-2214913 GGGATATTTATAGCATTACATGG + Intergenic
1153203827 18:2675103-2675125 GGGATATTATCCCCATTTTATGG - Intronic
1153606004 18:6833796-6833818 GGGATGTTTATACAGTTTGAAGG - Intronic
1156185783 18:34661666-34661688 GGCATATTTTCACCACTAGAGGG + Intronic
1159683336 18:71383932-71383954 GGGATATATACAGAATTTTAGGG - Intergenic
1166148184 19:40851293-40851315 GAGATTTTTCCACCATTTGGGGG - Intronic
1166152326 19:40883078-40883100 GAGATTTTTCCACCATTTGGGGG - Intronic
1166177849 19:41087582-41087604 GAGATTTTTCCAGCATTTGAGGG + Intergenic
928321388 2:30285211-30285233 GGGATATTTACACCATTTGAAGG + Intronic
928810755 2:35222018-35222040 GAGATATTTATCCCCTTTGATGG + Intergenic
929115720 2:38442265-38442287 GGGAAGTTCACACCATTTGCAGG + Intergenic
930414752 2:51077375-51077397 GGGAGATGAACAGCATTTGAAGG + Intergenic
931554732 2:63489822-63489844 AGGATATTTACATAATTTCAAGG + Intronic
933800214 2:85954505-85954527 GGGAGATTGACACCATGAGAAGG - Intergenic
935454778 2:103254645-103254667 GGGAAATTCACACCATTACATGG + Intergenic
936399394 2:112154296-112154318 TGAAAATTTATACCATTTGAGGG + Intronic
936777180 2:115987776-115987798 AGAATATTGACACCATTAGAAGG - Intergenic
939355082 2:141091201-141091223 GGGATTTGTAGGCCATTTGAAGG + Intronic
940769197 2:157822293-157822315 GGAGTATTTACCCCATTTCATGG - Intronic
1171911543 20:30964119-30964141 GGGATATTTACAGCACTTTGGGG - Intergenic
1173762590 20:45576816-45576838 TGTAGATTTACACGATTTGAAGG - Intronic
1175353548 20:58344192-58344214 GGGAACTTTACAGCATATGAAGG + Intronic
1177385569 21:20405445-20405467 GGTACTTTTACACCATTTGAAGG + Intergenic
1179390226 21:40982155-40982177 GAGAAATTAAGACCATTTGATGG + Intergenic
953596904 3:44324500-44324522 GGCATATAAACACCTTTTGATGG - Intronic
954248436 3:49349917-49349939 GTGAGAATTACACCATTTCAGGG + Intergenic
954613996 3:51960283-51960305 GAGACATTTCCACCATTTGCAGG + Exonic
956547807 3:70425330-70425352 AGGATATTTGCAAAATTTGAAGG - Intergenic
957743581 3:84306600-84306622 GGCATATTTACATCATTTTATGG - Intergenic
958136187 3:89495840-89495862 GGGATCTTTGCATCATTTAATGG + Intergenic
958915710 3:100047966-100047988 GGTATATTTACACTATAGGAGGG - Intronic
962381167 3:134899132-134899154 GGGCTTTTCACACCATTTGAGGG + Intronic
963874152 3:150454775-150454797 GAAATATTAACACCATTTAAGGG + Intronic
963977162 3:151493774-151493796 GGGAGGTTTACACCATATTATGG - Intergenic
964231677 3:154477407-154477429 GTCATATTTATACCATTTGTAGG + Intergenic
964530920 3:157666855-157666877 AGGATATTTTCAACATATGATGG - Intronic
965696048 3:171409366-171409388 ACGATATTTACACCATCTGTAGG + Intronic
968199914 3:196743431-196743453 GGGATATTTAGATCAAATGAGGG + Intronic
969435383 4:7186289-7186311 GGGAGATTAACACCAGGTGAGGG - Intergenic
972466693 4:39364124-39364146 GGCATATACACACCATTTTAAGG - Intronic
980705448 4:136487197-136487219 GTCATATTTATACCATTTTAAGG - Intergenic
981343554 4:143649511-143649533 GGGAAATTTAAACCTTGTGAAGG - Intronic
984219109 4:176951771-176951793 GGGAAGTTTGCACCATTTGCAGG - Intergenic
988585969 5:32507834-32507856 GGGAAGTTCACACCATTTGCAGG - Intergenic
989691182 5:44146148-44146170 GAGATATGTGCACAATTTGAAGG - Intergenic
992481079 5:77153007-77153029 GGGATATTTGCAACACTTGGAGG + Intergenic
992986053 5:82230787-82230809 TGGATATTTACATCATTCCATGG - Intronic
994063601 5:95509468-95509490 GGGATGTTCACGCCATTTGCAGG - Intronic
996905751 5:128597598-128597620 GGAATGTTTTCAGCATTTGATGG - Intronic
1000529495 5:162401669-162401691 GGGATATTTACCCCATTTTAAGG - Intergenic
1001474340 5:172039327-172039349 GGGACATTTACACCATAGCAAGG + Intergenic
1005167958 6:22947376-22947398 GAAATATATACAGCATTTGATGG - Intergenic
1005314554 6:24591947-24591969 GGTATATTTATCCCATTTTATGG + Intronic
1006699314 6:35958919-35958941 GGGAATTTTACAGCATTTGGAGG - Intronic
1008265189 6:49416471-49416493 GGGATATTTTGACCATGTGCTGG - Intergenic
1008766232 6:54918858-54918880 CGGGGAGTTACACCATTTGAGGG - Intronic
1010535473 6:77023680-77023702 GGAATAATAACACCATTTTATGG + Intergenic
1011591278 6:88972683-88972705 GGGAAGTTTGCACCATTTGCAGG + Intergenic
1011616818 6:89204959-89204981 GGCATCTTTTCACCATCTGAGGG + Intronic
1012174326 6:96060871-96060893 TGGACATTTACAGCATTTAAAGG + Intronic
1012880940 6:104788757-104788779 GGGAAATTTGGAGCATTTGAAGG - Intronic
1012940690 6:105411507-105411529 AGGATATTTTCACCATTCCAGGG - Intergenic
1013276368 6:108588914-108588936 GGAATACTTACACTTTTTGATGG + Intronic
1013612551 6:111808450-111808472 GGGATAGTGACCCCATTTCAGGG + Intronic
1023847673 7:44131850-44131872 GGGATATTGACAGCACCTGATGG - Intergenic
1024489744 7:49966857-49966879 TGGGAATTTACACCATTAGATGG - Intronic
1028414090 7:90561440-90561462 AGGATATTTTCAACTTTTGATGG - Intronic
1030511535 7:110488691-110488713 GGGCTATTTTCAGCTTTTGATGG + Intergenic
1037790041 8:21930833-21930855 GAGATATTTACAACATCTAAAGG - Intronic
1038449064 8:27627275-27627297 GAGATCTTTACAACATCTGAGGG + Intergenic
1039493056 8:37962167-37962189 GGGAGATTTACATCCTTGGATGG - Intergenic
1043846176 8:85166496-85166518 GGGAGATTTTTACCCTTTGAAGG + Intergenic
1046240448 8:111484001-111484023 GGGACATTTACAATATTTGTAGG + Intergenic
1046337905 8:112813921-112813943 GGGACATTTGCACCATTTGCAGG - Intronic
1046359232 8:113129252-113129274 GGGATATTCCCACCATTTGAAGG + Intronic
1049966616 9:785791-785813 GGGAGATATACAGCATTTGCTGG - Intergenic
1052036689 9:23689804-23689826 CGGATATCGACACCATTTTATGG - Intergenic
1055105689 9:72510831-72510853 GGGATTTTTACACTATTTGGAGG - Intergenic
1057417710 9:94879726-94879748 AGTATATTTCCACCATCTGATGG - Intronic
1060478936 9:124006235-124006257 GGGAAATTTACATCATTGCATGG + Intronic
1061035404 9:128111227-128111249 GGGATCTTTTCACCTGTTGATGG - Intergenic
1186011317 X:5137269-5137291 GGGATATTTACAGCCTTACAGGG + Intergenic
1186116330 X:6308456-6308478 AGGATATTTTCACAGTTTGAAGG + Intergenic
1187199501 X:17121271-17121293 GTGATACTTACAAAATTTGATGG - Intronic
1190991047 X:55550850-55550872 GTGATATATACAACAATTGAGGG - Intergenic
1191390122 X:60123294-60123316 GGGATATTTGGACCTTTTGAAGG + Intergenic
1191431131 X:60673053-60673075 GGGATATTTGGACCTTTTGAAGG + Intergenic
1191552575 X:62297965-62297987 GGGATATTTGGACCTTTTGAAGG + Intergenic
1192148618 X:68698173-68698195 CAGTTATTCACACCATTTGAAGG + Intronic
1193393561 X:80957653-80957675 TGTATATTTCCACCACTTGATGG - Intergenic
1195058949 X:101175345-101175367 TGGATATTTACCCCATTATAAGG + Intergenic
1195524450 X:105870536-105870558 GGGATACATACAACATTTGCAGG - Intronic
1198409201 X:136348702-136348724 GGGATAGTGACTCCATTTGTAGG + Exonic
1199208827 X:145182044-145182066 GGCTTATTTATAACATTTGAGGG + Intergenic