ID: 928323738

View in Genome Browser
Species Human (GRCh38)
Location 2:30303572-30303594
Sequence CAGGACCTTCAACCAGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928323738_928323744 9 Left 928323738 2:30303572-30303594 CCCTGGTCTGGTTGAAGGTCCTG 0: 1
1: 0
2: 1
3: 14
4: 134
Right 928323744 2:30303604-30303626 TTGGCCCAGTATTTTCGACATGG 0: 1
1: 0
2: 0
3: 1
4: 56
928323738_928323742 -10 Left 928323738 2:30303572-30303594 CCCTGGTCTGGTTGAAGGTCCTG 0: 1
1: 0
2: 1
3: 14
4: 134
Right 928323742 2:30303585-30303607 GAAGGTCCTGGTGGAAAAATTGG 0: 1
1: 0
2: 0
3: 27
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928323738 Original CRISPR CAGGACCTTCAACCAGACCA GGG (reversed) Intronic
904614100 1:31740578-31740600 CAGGAGCTGGAACCAGACCCTGG + Intronic
907273586 1:53304770-53304792 CAGCACCTCCAACCAGAGCTGGG + Intronic
907371099 1:54004234-54004256 CAGTCCCATCAACCTGACCAAGG - Intergenic
908008709 1:59753844-59753866 CAGGATTTTTAACCAGAGCAGGG - Intronic
908834004 1:68210275-68210297 CAGGAGTCTAAACCAGACCAGGG + Intronic
913212164 1:116590665-116590687 CAGGAACTGCATCCAGACCCAGG + Intronic
916485779 1:165257376-165257398 CAAGACCTTCTACAAAACCATGG - Intronic
918406504 1:184216206-184216228 CAGTTCCTTCAACCAGAACAAGG + Intergenic
919854408 1:201695661-201695683 CAGGGCCTGCATCCAGCCCACGG - Intronic
920100666 1:203515223-203515245 CAGGAGCTTCCACCAGTCCTAGG - Intergenic
922477935 1:225919724-225919746 CAACACCTTGATCCAGACCAAGG + Intronic
922723021 1:227908369-227908391 CAGGACCTACGACCATGCCATGG + Intergenic
1063064905 10:2598853-2598875 CAGGACCTTCCTAGAGACCATGG + Intergenic
1064549100 10:16480528-16480550 GAGTACCTTCAACCAGGTCAAGG + Intronic
1066961909 10:42233010-42233032 CAGGACCAGCAACCAGGCTAGGG + Intergenic
1067231606 10:44415895-44415917 CAGGACATACACACAGACCAGGG - Intergenic
1067702505 10:48583901-48583923 CAGCACCATCAACCAGAATAAGG - Intronic
1069222432 10:65901503-65901525 CAGCACCTTGAACCAGAACAGGG - Intergenic
1069911366 10:71761804-71761826 CAGGACCTTCACCTGCACCATGG - Exonic
1071236613 10:83657250-83657272 CAGGACCATCCCCCAGACCCAGG - Intergenic
1071597789 10:86940715-86940737 CGGGACCTTCAACAAGGCCTTGG + Intronic
1073391868 10:103185133-103185155 CCGGACCTTCAACAATAACATGG + Intronic
1073594549 10:104786877-104786899 CAGAACCTTCCACCACCCCAAGG + Intronic
1075003882 10:118817036-118817058 CAGGCCCTTCCACCTGAGCAGGG + Intergenic
1076453263 10:130571649-130571671 CAGGTCCTACACACAGACCAGGG - Intergenic
1077453624 11:2665147-2665169 CAGGACCCTCAACCAGCTCTGGG + Intronic
1077573675 11:3360523-3360545 CAAGACCTTCTGCCAGAGCAGGG - Exonic
1081873652 11:46394584-46394606 CAGGACCCACTATCAGACCAAGG + Intergenic
1083799102 11:65036017-65036039 CAGGATCTGCAGCCAGACCCTGG - Intronic
1083961154 11:66015740-66015762 CAGTGCCTTCCGCCAGACCAGGG + Intergenic
1085446187 11:76602705-76602727 CCAGACCTTCACCCAGGCCAGGG - Intergenic
1090414402 11:126530713-126530735 CAGCACCTTCCACCGGCCCAGGG + Intronic
1091386083 12:95832-95854 TAATACCTTCAACCATACCATGG - Intronic
1092478769 12:8841440-8841462 TGGAACCTTCAACCAGACCCTGG + Exonic
1102681093 12:114691221-114691243 CAGGACCTACATCCTGACCTTGG - Intergenic
1105215410 13:18281287-18281309 CAGGAACTGCATCCAGACCCAGG + Intergenic
1107455730 13:40552943-40552965 CATGACAATCAACCAAACCATGG + Intergenic
1112435044 13:99385914-99385936 CAGAACCTTGAACCAGTGCATGG - Intronic
1114334127 14:21670282-21670304 CAGGACCACAAAACAGACCACGG + Intergenic
1115770212 14:36659238-36659260 CAGGACCTAGAACAAGAACAAGG - Intronic
1118887767 14:69880441-69880463 CAGAAACTCCAATCAGACCAAGG - Intronic
1122775011 14:104113242-104113264 CAGGAGCTTCAGGCAGAGCAGGG - Exonic
1122825549 14:104368847-104368869 CGTGACCGTCAACCAGAGCAGGG + Intergenic
1122952246 14:105051446-105051468 CAGGAGCATCAAGCAGAGCATGG - Exonic
1123082024 14:105699893-105699915 CAGGACCTTCGCCCACTCCACGG + Intergenic
1129936667 15:79456719-79456741 CAGGGCCTGCAACCTGTCCAGGG - Exonic
1132560565 16:591396-591418 CAGCACCTGCCACCAGACCTGGG - Intronic
1133410031 16:5560529-5560551 CAGGAGATTCAAACAGACAAAGG - Intergenic
1135268614 16:21049774-21049796 CAGCTCCTTCAAGCAGAGCAAGG - Intronic
1136057548 16:27701648-27701670 CAGGGCCATCAACCAGGCCATGG + Exonic
1138382380 16:56611517-56611539 CTGGACCTGCAACCTGCCCAAGG + Intergenic
1140656300 16:77143535-77143557 CTGTACCCTCAACCAGGCCAGGG + Intergenic
1141535127 16:84673842-84673864 CAGGTCCTTTAGGCAGACCAGGG - Intergenic
1143259758 17:5589331-5589353 CAGGACATTAAAGCAGACCATGG - Intronic
1145283912 17:21489560-21489582 CAGGACCTGCACCCAGGCCATGG - Intergenic
1146301790 17:31695302-31695324 CTGGTCCTCCAACCAGCCCATGG + Intergenic
1147981069 17:44274371-44274393 CAGGTCCTTAAACCTGACCAGGG + Intergenic
1149259829 17:54867089-54867111 CAGGACCTTCACACAGACACTGG - Intergenic
1152636235 17:81431561-81431583 CAGGCCCTTTATCCAAACCAGGG - Intronic
1153068937 18:1082396-1082418 CAGGAGCTTCAAGCAGAAAAGGG - Intergenic
1156279784 18:35625695-35625717 CAGGAACTTCCTCCAGGCCAGGG - Intronic
1158227581 18:55216862-55216884 CAGAACCTTCACACATACCAGGG - Intergenic
1160221917 18:76984309-76984331 GAGGACCTGGAACCAGACCCAGG - Intronic
1160429479 18:78801617-78801639 CAGCAGCTTCACCCAGAGCATGG + Intergenic
1161172976 19:2822553-2822575 CAGGACCTTCATCCATAAAATGG + Intronic
1161686204 19:5703910-5703932 CAGGTACTTCCACCAGCCCAAGG + Intronic
1164245121 19:23421828-23421850 CCGGAGCTACAACCAGGCCAGGG - Intergenic
1164685268 19:30162350-30162372 GAGGACCTGCAGCCAGACCTGGG + Intergenic
1165829905 19:38725331-38725353 CAGGAGCTGCAGCCAGGCCAGGG + Intronic
1167306559 19:48713378-48713400 CAGGGCCTCCAGCCAGTCCAGGG + Exonic
1168324528 19:55531142-55531164 CATGGCCTTCATCCAGCCCAAGG - Exonic
926913022 2:17869085-17869107 CATGAGCTTCTACCAGACCTAGG + Intergenic
928215985 2:29361798-29361820 CAGGACCTCCAACCAGATAGCGG - Intronic
928323738 2:30303572-30303594 CAGGACCTTCAACCAGACCAGGG - Intronic
930269076 2:49234445-49234467 CAGTGCCTTCAACCAGATGAGGG + Intergenic
932343832 2:70982981-70983003 GAGAACCTTCAATGAGACCAAGG + Intronic
934298919 2:91765440-91765462 CAGGAACTGCATCCAGACCCAGG - Intergenic
937792364 2:125975785-125975807 CAAGTCCTTCAAAGAGACCATGG + Intergenic
938179111 2:129163660-129163682 CAGGACATTTAAGCTGACCATGG - Intergenic
939039224 2:137167841-137167863 TAGTACCTTCAACTAAACCACGG + Intronic
944144501 2:196492292-196492314 CTGGACCGTCATCCAGACCATGG + Intronic
946112274 2:217430429-217430451 CAGGACCTGCCTCCAGGCCATGG - Intronic
946547993 2:220766685-220766707 CATCACCATCAACCAGCCCAAGG + Intergenic
947959732 2:234225724-234225746 GAAGACCTTCCAGCAGACCAGGG - Intergenic
948687339 2:239677492-239677514 CAGGGGCTCCAACCAGAGCAAGG + Intergenic
948712534 2:239833875-239833897 CAGGACCATCAACCCCACCAAGG + Intergenic
948772562 2:240259043-240259065 TAGGACCCTGAACCAGACCCAGG - Intergenic
949045218 2:241869786-241869808 CAGCACCTTCACCCTGGCCATGG + Exonic
1170251760 20:14291217-14291239 CAGGACATTCATCCAGTCCTAGG + Intronic
1179273119 21:39866713-39866735 GGAGACCTTCAACCAGGCCAGGG + Intergenic
1179547919 21:42124758-42124780 CAGGACCTTTGAGCAGTCCAAGG + Intronic
1183032059 22:35113781-35113803 CAGTCCCTTCAGCCAGAACATGG - Intergenic
949363664 3:3257814-3257836 CAGTACCTTCACCGACACCAAGG + Intergenic
950465027 3:13148637-13148659 CAGGAACTCCAACCAGAGGATGG - Intergenic
952272049 3:31842860-31842882 CATGACCTTCACCCAGAGCCAGG + Intronic
954300652 3:49699187-49699209 CAGGGCCTGCCACCAGCCCATGG - Intronic
954458623 3:50613208-50613230 CAGGCCCTTCAACAAGGCCAGGG - Intronic
954796742 3:53165326-53165348 CAGGGCCCACAACCAGATCAAGG - Intronic
964284382 3:155101642-155101664 CATGACCTTTTGCCAGACCACGG + Intronic
966121319 3:176524172-176524194 CAGGAGCTCCGTCCAGACCAAGG + Intergenic
970031799 4:11684621-11684643 CCTGACCTTGAACCAGAGCATGG + Intergenic
972391372 4:38616690-38616712 CAGACCATTCAACCAGACCCTGG + Intergenic
979772578 4:124546794-124546816 CAGAACCTTAAAACGGACCAAGG - Intergenic
983395872 4:167195135-167195157 CAGGATCTGCAGTCAGACCAAGG + Intronic
985713037 5:1441146-1441168 CAGGACCCTCACCTAGAGCAAGG + Intronic
994497838 5:100535731-100535753 CCGCAGCTTCAGCCAGACCACGG - Exonic
997605700 5:135174333-135174355 CAGGACCTTCAGGAAGTCCACGG - Intronic
998489029 5:142529786-142529808 CAGGTTGTTCAACAAGACCAAGG + Intergenic
999116584 5:149169430-149169452 CAGGACCCTCTCCCACACCAGGG + Intronic
1002474641 5:179457376-179457398 TAGGACCTTCAGAAAGACCATGG + Intergenic
1005582885 6:27250790-27250812 CAGGACCTTCAGCCGGGCCCAGG - Exonic
1006651554 6:35555871-35555893 CAGGACGTTCACGCACACCATGG - Intergenic
1014100522 6:117506580-117506602 GAGGATGTTCAAACAGACCAGGG - Intronic
1018800601 6:167219276-167219298 CAGCAGCTTCAACCACGCCATGG - Intergenic
1019165174 6:170093887-170093909 CAGGCCCTACAGCCAGGCCAAGG - Intergenic
1021201281 7:17730911-17730933 CAGGACTCACACCCAGACCATGG - Intergenic
1021563907 7:21998236-21998258 TAGGACCTTCCAGCAGAGCAAGG - Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1025222149 7:57121110-57121132 CAAGACCTTCAGCCAGAGCAGGG - Exonic
1025266852 7:57468744-57468766 CAAGACCTTCAGTCAGAGCAGGG + Exonic
1025632932 7:63292781-63292803 CAAGACCTTCAGCCAGAGCAGGG - Intergenic
1025649765 7:63455402-63455424 CAAGACCTTCAGCCAGAGCAGGG + Intergenic
1025721086 7:64015048-64015070 CAAGACCTTCATCCAGAGCAGGG + Intergenic
1034367508 7:150564065-150564087 CAGGAACTTAAAACAGACAACGG - Intergenic
1035563203 8:623826-623848 CATGACCTTGGATCAGACCATGG + Intronic
1035714420 8:1743237-1743259 CAGGATCTTCATCTAGAGCAGGG - Intergenic
1036450574 8:8863678-8863700 CTGGTCCTTAACCCAGACCATGG + Intronic
1039959869 8:42238053-42238075 AAGGACTTTCACCAAGACCAGGG + Intergenic
1043001677 8:74767533-74767555 CAGGACTTTCAACCATCTCATGG - Intronic
1044034115 8:87276435-87276457 CAGAACAAGCAACCAGACCATGG - Intronic
1044819705 8:96147308-96147330 CAAGACCTTCAAACAGACCAGGG + Intronic
1045052370 8:98338839-98338861 CAGGCCTCTCAAGCAGACCATGG + Intergenic
1048468518 8:134686997-134687019 CAGCATCTTCAACCAAAGCAAGG + Intronic
1049241094 8:141537701-141537723 CAGGACCATGACCCAGCCCAGGG - Intergenic
1052157418 9:25209948-25209970 TAAGATCTTCAACCAGACAATGG + Intergenic
1054723659 9:68628419-68628441 AATGACCTTCACCCAGACTATGG + Intergenic
1056622163 9:88223592-88223614 CAGGAGCTTCAATCAGAAGAAGG + Intergenic
1058602477 9:106684917-106684939 CAGGACCTCCACCAAGCCCAGGG - Intergenic
1058785387 9:108381623-108381645 CAGAACCTACAACCAGCCAAGGG + Intergenic
1060731139 9:126037773-126037795 CAGAAACTTCCCCCAGACCAGGG - Intergenic
1061084027 9:128389011-128389033 CAGCACCACCACCCAGACCATGG - Intronic
1062194731 9:135266703-135266725 CAGGGCCTTCAAGCAGCCCCTGG + Intergenic
1062686568 9:137816782-137816804 CAGGCCTTTCTACCATACCAAGG - Intronic
1203360483 Un_KI270442v1:216861-216883 CGGGACCTTCCACCCCACCAGGG + Intergenic
1186519747 X:10194938-10194960 CAGGTCCGTCATCCAGTCCACGG - Exonic
1192772022 X:74203067-74203089 CAGGACCTGCACCCAGACTAGGG + Intergenic
1200335689 X:155349004-155349026 CAGGACCATAAACAAAACCAAGG - Intergenic
1200350780 X:155492221-155492243 CAGGACCATAAACAAAACCAAGG + Intronic
1201190468 Y:11439092-11439114 CAGGACCAGCAACCAGGCTAGGG - Intergenic
1202584540 Y:26409312-26409334 CAGGCCCTGCACCCAGGCCAGGG + Intergenic