ID: 928324647

View in Genome Browser
Species Human (GRCh38)
Location 2:30309848-30309870
Sequence GCTGTGGACTGAAGCCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928324647_928324656 9 Left 928324647 2:30309848-30309870 CCTCCTTGGCTTCAGTCCACAGC 0: 1
1: 0
2: 0
3: 24
4: 216
Right 928324656 2:30309880-30309902 CCTCCACAATCTTATCTTCTGGG 0: 1
1: 0
2: 0
3: 19
4: 161
928324647_928324654 8 Left 928324647 2:30309848-30309870 CCTCCTTGGCTTCAGTCCACAGC 0: 1
1: 0
2: 0
3: 24
4: 216
Right 928324654 2:30309879-30309901 ACCTCCACAATCTTATCTTCTGG 0: 1
1: 0
2: 4
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928324647 Original CRISPR GCTGTGGACTGAAGCCAAGG AGG (reversed) Intronic
900368617 1:2321627-2321649 GCAGTGGGCTGAGGCCAGGGAGG - Intronic
900391450 1:2435714-2435736 GCTGTGGAGTACAGCCAGGGTGG + Intronic
900402146 1:2476949-2476971 CCTGGGGGCTGAACCCAAGGGGG + Intronic
900496795 1:2979350-2979372 GCTGTGTTCAGGAGCCAAGGAGG + Intergenic
900530131 1:3149013-3149035 GCTGGGGACAGAAGCCGGGGTGG - Intronic
901211723 1:7530203-7530225 GCTGTAGCCTGAGGCCAAGGTGG - Intronic
901261089 1:7871419-7871441 GCTGTGGAGTGAAGCCAGCCTGG - Intergenic
902384256 1:16067431-16067453 GGTGTGGACTGAAAGAAAGGGGG - Intronic
902976547 1:20092693-20092715 GCTGTTCACAGCAGCCAAGGTGG - Intergenic
905206238 1:36344282-36344304 GCTGTGGCCTGAAGACAGTGTGG - Intronic
906706453 1:47898468-47898490 GCTCTGGAGGGAAGCCAGGGAGG + Intronic
908199833 1:61782922-61782944 GCTGTGTTCTGAAGACAACGAGG - Intronic
912680616 1:111726797-111726819 GCTCAGGACTGAAGGGAAGGTGG - Exonic
915558380 1:156672885-156672907 CCTGCGGGCTGAAGCCAGGGTGG - Exonic
916519805 1:165553483-165553505 GCTGTGGACTGAAGGGAATAGGG + Intronic
918875749 1:190040598-190040620 TCTGTAGACAGAAGACAAGGTGG + Intergenic
919765944 1:201127405-201127427 GCTCTGGGCTGGAGCCTAGGAGG + Intergenic
919801947 1:201359496-201359518 CCTGTGGGCTGAAGCAGAGGAGG + Intronic
921291708 1:213663854-213663876 GCTGTGGGCTGATGGGAAGGAGG - Intergenic
922466455 1:225848241-225848263 GCAGGGAACTGAAACCAAGGGGG + Intronic
922763957 1:228148188-228148210 CCTGAGGACTGAGGCCCAGGGGG + Intronic
922766586 1:228159315-228159337 GCTGTGGTCTGAACCCCAGGGGG + Exonic
923469777 1:234280164-234280186 GCAATGGATTGAAGCCAATGAGG - Intronic
1063430779 10:5986211-5986233 GCTGAGGACAGAGGGCAAGGTGG - Intergenic
1064014279 10:11760715-11760737 GCTGGGATCAGAAGCCAAGGTGG - Intronic
1066258367 10:33704027-33704049 AGTTTGGACTGAAGACAAGGAGG + Intergenic
1070551522 10:77494287-77494309 GCCCTGGCCTGAAGCAAAGGAGG - Intronic
1070809745 10:79291733-79291755 GGTGAGGGCTGAGGCCAAGGTGG - Intronic
1072533863 10:96344636-96344658 GCTGAGGACTGTCTCCAAGGAGG - Exonic
1072948899 10:99835477-99835499 CCTGTGGCCTGAGGGCAAGGGGG - Intronic
1073320503 10:102613508-102613530 GCTGGGGCCTGCAGCCAGGGTGG - Intronic
1075961194 10:126568845-126568867 GCTGAAGAGTGAAGACAAGGAGG + Intronic
1076065532 10:127444889-127444911 GATGTGGCCACAAGCCAAGGAGG - Intronic
1077888243 11:6401782-6401804 GCTGTGGGCAGAAGCCCTGGAGG - Intronic
1079117374 11:17648765-17648787 GCTGCCAACTGGAGCCAAGGAGG - Intergenic
1081206349 11:40280277-40280299 GCTGTTCACTGAAGCCAAGAAGG - Intronic
1083262456 11:61530652-61530674 GCTGGTGACTGAAGCCCAGCTGG + Intronic
1083729714 11:64646179-64646201 GCTGTGGAGCTAAGACAAGGTGG - Intronic
1083902487 11:65650386-65650408 GCTCTGGCCTGAAGACATGGGGG - Exonic
1084264878 11:67999726-67999748 ACTGTGGCCTGAAGCCAAACGGG + Intronic
1084823019 11:71706920-71706942 GATGTGGACTGAGTCAAAGGAGG - Intergenic
1084843018 11:71873272-71873294 CCTGTGGATTGCAGCCAAAGTGG - Intronic
1087663669 11:101017085-101017107 GCTGTGAACTTAGGCAAAGGAGG - Intergenic
1088886616 11:114012725-114012747 GCTGGAAACAGAAGCCAAGGAGG - Intergenic
1089433190 11:118438485-118438507 GCTAGGGGCTGAAGCGAAGGGGG + Intronic
1089679985 11:120113935-120113957 GCTGTGACCTCAAGCCAGGGAGG - Intronic
1090273892 11:125406242-125406264 GCCGTGGAATGGAGACAAGGAGG - Intronic
1091038333 11:132254006-132254028 GCTGGGAACTCAAGCCAAGCAGG + Intronic
1091738703 12:2944496-2944518 GCTGTGGACTGAAGAGAAGCAGG - Intergenic
1092481878 12:8866663-8866685 TTTGTGGACTGGAGCCAGGGAGG - Intronic
1092759363 12:11795598-11795620 GATGTGGACAGAAGCCCTGGAGG - Intronic
1095960105 12:47828986-47829008 GCTCTGGACTCAAGCAAAGAGGG - Intronic
1096235294 12:49922232-49922254 GCTGGGGACTGGGGCCAAGGTGG + Intergenic
1098463810 12:70764094-70764116 CCTGAGGACTGCAGCCCAGGTGG - Intronic
1099405859 12:82261587-82261609 GCTGTGGACTGACATCAGGGTGG - Intronic
1102512138 12:113422789-113422811 GCTGTGGAGTGCCACCAAGGTGG + Intronic
1103446116 12:120996392-120996414 GCTGAGTACAGAAGCCAAGCTGG + Exonic
1104060304 12:125262306-125262328 TCTTTGGACTGAATCCAAGCTGG - Intronic
1104820239 12:131672862-131672884 GCTGTGGCCTGAAGCCAGCGAGG - Intergenic
1105642459 13:22279679-22279701 GCTGTGGGCTCAAGGCAGGGGGG + Intergenic
1111476073 13:88749601-88749623 GCTGTGGAATGAAGCAAAAGAGG + Intergenic
1112045322 13:95590771-95590793 GCTGTGGCCTGAAGGACAGGTGG + Intronic
1112237508 13:97649568-97649590 TCTGTGGACTGATGCCATGAAGG + Intergenic
1114558598 14:23576332-23576354 GCTGTGGCCGGAATCCAGGGAGG + Exonic
1118044358 14:61950487-61950509 GCTGTGCACTGAAGCATGGGAGG - Intergenic
1121422867 14:93827856-93827878 GCAATGGACTGCAGCCATGGAGG - Intergenic
1121827572 14:97022938-97022960 TCTGTGGCCACAAGCCAAGGAGG - Intergenic
1122806489 14:104262636-104262658 GCTGTGGACCAAAGCCAGAGGGG + Intergenic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1123125299 14:105941682-105941704 GGGGTGGACTGTAGCCACGGAGG + Intergenic
1124220172 15:27844289-27844311 GTTGCAGACTGAAGCCAGGGTGG - Intronic
1125508674 15:40281641-40281663 GGTGGGGACTGAGGCCAATGGGG + Exonic
1125983275 15:44023420-44023442 GCTGTGGACAGAAAACAGGGAGG + Intronic
1126364895 15:47884042-47884064 GGTGGGGACTGAGGGCAAGGAGG - Intergenic
1129800335 15:78409079-78409101 GCTGTGGCCTCAAGCCAACCAGG + Intergenic
1132345448 15:101105504-101105526 GCTGCAGACTGCAGACAAGGGGG + Intergenic
1132578195 16:673548-673570 GCTGAGGACTGCGGCCACGGCGG - Exonic
1132654359 16:1035733-1035755 GCTGTGGACAGAAGCCAGTGAGG + Intergenic
1132728759 16:1350395-1350417 GGTGTGGACTGTAGCAAGGGAGG - Intronic
1133019888 16:2962769-2962791 TCTGTGGACTGGAGCCCGGGAGG + Intergenic
1133225506 16:4338593-4338615 GCTGTGGACTGAAGGCCTTGAGG + Exonic
1134071941 16:11265708-11265730 GCTTTGGGCTAAGGCCAAGGAGG - Intronic
1135482475 16:22832569-22832591 ACTGTGGTCTGAGGCCAGGGTGG + Intronic
1138508015 16:57487798-57487820 GCTGTGGTTTGAAGCAAAGCAGG - Intergenic
1139334013 16:66218199-66218221 GCTGTGGACTTAGGCTGAGGGGG - Intergenic
1139389570 16:66598202-66598224 GCTATGGAATGAAGGCAGGGTGG - Intergenic
1139841890 16:69888367-69888389 GCTGTGCATTGAAGCAAGGGAGG + Intronic
1141251155 16:82360212-82360234 GCTGCTGACTGAGGACAAGGGGG + Intergenic
1141825861 16:86479992-86480014 GCTGTGTAATTAAACCAAGGGGG - Intergenic
1142007684 16:87697445-87697467 GCTAAGCACGGAAGCCAAGGGGG + Exonic
1143118147 17:4592089-4592111 GCTGAGGACAGAAGTCAAGATGG - Intronic
1143724837 17:8837776-8837798 GCTGGGGACTGAGGTCGAGGTGG - Intronic
1144886226 17:18464354-18464376 GATGTGGGCAGAAGACAAGGAGG - Intergenic
1145145982 17:20480015-20480037 GATGTGGGCAGAAGACAAGGAGG + Intergenic
1148060088 17:44830189-44830211 GCTGGAGACTGAGGCGAAGGCGG - Intronic
1149518161 17:57296384-57296406 GCTGTGGAGAGAGGCCAGGGTGG + Intronic
1149660502 17:58331989-58332011 GCTGGGGACTGAGGCCCTGGGGG - Intergenic
1149911983 17:60575079-60575101 GATGTGGCCACAAGCCAAGGTGG + Intronic
1151051620 17:70984846-70984868 GCTGGGAACTGGAGCAAAGGTGG - Intergenic
1151690945 17:75684995-75685017 GCAGTGCAATGGAGCCAAGGAGG - Intronic
1151991225 17:77575901-77575923 GCTGTGGCCTGAGGGCAGGGGGG - Intergenic
1152575002 17:81136158-81136180 GGTGTGGACTGATGCCAGGCGGG - Intronic
1155161046 18:23196310-23196332 GCTGTAGGCTGAGGCCACGGCGG + Intronic
1156452265 18:37273657-37273679 GCTGCGGAATGTGGCCAAGGCGG + Intronic
1157621474 18:49019424-49019446 GCTGTGGCCTGCAGCCAGAGAGG - Intergenic
1158073704 18:53504030-53504052 TCTGAGGACTGAAGACAAGGAGG + Intronic
1159528236 18:69621586-69621608 GCTGGGGAGTGAGGCCATGGTGG + Intronic
1164943307 19:32268552-32268574 TCTGTGGAGGGAAGCCAAGAAGG + Intergenic
1166211390 19:41308743-41308765 GTTGTGGAAGAAAGCCAAGGAGG - Intronic
1166458442 19:42964643-42964665 GCTATGGATAGAAACCAAGGTGG - Intronic
1167232093 19:48291201-48291223 GCCGTGGACTGAAGCCGGGACGG + Intergenic
1167395181 19:49223791-49223813 GCTGTGGACTGGATCCAAATTGG - Intergenic
924995727 2:358920-358942 GCTGTGGAGTGAGGCCAACCTGG + Intergenic
925432080 2:3803365-3803387 GCTTGGGACTGGAGCCAAGATGG - Intronic
927211513 2:20641828-20641850 GCTGTGGGGAGAGGCCAAGGAGG - Intronic
928324647 2:30309848-30309870 GCTGTGGACTGAAGCCAAGGAGG - Intronic
928425299 2:31172749-31172771 GCTGAGTACTGAAGACCAGGGGG - Intergenic
929883779 2:45860654-45860676 GCTGTGGACTGAAGGGAGTGAGG + Intronic
929949065 2:46392675-46392697 GCTGGGGACTGAAGTCACTGGGG + Intergenic
930048994 2:47199289-47199311 GCTCCTGACTGAAGCCAATGTGG + Intergenic
930203744 2:48568202-48568224 GGGGAGGACTGATGCCAAGGAGG - Intronic
932460417 2:71878678-71878700 GCTCAGGTCTGGAGCCAAGGCGG + Intergenic
932469098 2:71942348-71942370 CCTGTGGAGTGAAGGCCAGGTGG - Intergenic
932849451 2:75170701-75170723 GCTGGGAACTGGAGCAAAGGTGG + Intronic
934480295 2:94633135-94633157 GTTGTGGGCTGTAGCAAAGGTGG + Intergenic
937247678 2:120504043-120504065 GCTGTGGCCTCATGCCCAGGTGG + Intergenic
937503255 2:122506791-122506813 GCCATGGACTGAAGACAGGGAGG + Intergenic
938389288 2:130892646-130892668 GCTGAGGACTACAGCCAGGGTGG + Intronic
941079491 2:161044068-161044090 GCTGGGGAGGGAAGGCAAGGTGG - Intergenic
943024163 2:182608364-182608386 GCTGCGGGCTGAAGCCAGAGTGG - Intergenic
945874494 2:215264178-215264200 GCAGTGGACAGCAGCCATGGGGG + Intergenic
948720103 2:239894064-239894086 GCTGAGGACGGAAGGCAGGGAGG - Intronic
1169071818 20:2737412-2737434 GCTGGGGACTCAAGCCAACCTGG + Intronic
1169268342 20:4181244-4181266 GCTGAGGCCTGAAGCAAAGGGGG + Intronic
1170353815 20:15470599-15470621 GTTGTGGACACAAGCCAAGATGG - Intronic
1172304708 20:33872512-33872534 GGAGTGGACAGAAGCCGAGGAGG + Intergenic
1172629453 20:36368131-36368153 GCTGTGGAAGGAAGGAAAGGGGG + Intronic
1173163476 20:40669877-40669899 GCTGTGGACACAGGCCCAGGAGG + Intergenic
1173596451 20:44261659-44261681 GTTGTGGACTCAAGCCCAGGAGG + Intronic
1174063980 20:47851700-47851722 CCTGTGGGCTGAAGCCAGGGAGG + Intergenic
1174259201 20:49281291-49281313 GCTGTCGACTCCAGCCAATGGGG - Intergenic
1178273723 21:31217235-31217257 GCTCTGCAATGAAGCCAAGTGGG - Intronic
1178365598 21:31986665-31986687 GCTGTGGACTGAGCACAGGGAGG - Intronic
1179991168 21:44948955-44948977 GCTCTGGGAGGAAGCCAAGGCGG - Intronic
1182508704 22:30803433-30803455 GTTGTGGGCTGCACCCAAGGTGG - Intronic
1184117997 22:42433077-42433099 GCTGTGACCTGCAGCCAATGGGG - Intergenic
1185222399 22:49635781-49635803 GCGGTGGACAGAAGCCATGGAGG - Intronic
1185360514 22:50403942-50403964 GCACTGGACCTAAGCCAAGGTGG - Intronic
949710495 3:6864747-6864769 GCTGAGCACTGAAGGGAAGGAGG + Intronic
954608664 3:51932814-51932836 GCTGTGGGGTGAAGCCAGCGAGG - Intergenic
954681539 3:52348760-52348782 GATGTGGCCTGAAGCCTAGAGGG - Intronic
955656446 3:61250254-61250276 GCCGCAGGCTGAAGCCAAGGAGG + Intronic
956394409 3:68810211-68810233 GCTGTAGACTGGAGCCAAGATGG - Intronic
959262791 3:104102854-104102876 GCTGTGGGATTAAGCCAAGGGGG + Intergenic
961568741 3:127783434-127783456 GTTGTGGGCTGATGTCAAGGTGG - Intronic
963470436 3:145735110-145735132 GCTATGGACTGAAGCAGTGGGGG - Intergenic
966651331 3:182304216-182304238 GCTGTGGCCTGGAGCAAGGGTGG + Intergenic
966758145 3:183390647-183390669 GCTGGGTACTGAGGCCGAGGGGG + Intronic
967556436 3:190863945-190863967 GCAGTGGACATAAGCCAAGGTGG - Intronic
968734185 4:2286754-2286776 GCTGTGTCCTGAAGACAGGGTGG + Intronic
969784106 4:9439330-9439352 CCTGTGGATTGCAGCCAAAGTGG - Intergenic
969858706 4:10019564-10019586 GATGGGGACTGAAGTCCAGGTGG + Intronic
969870289 4:10100399-10100421 GCTGTGCACTGAAGACTAGTTGG - Intronic
972426521 4:38938170-38938192 GCTGCTGAGTGAAGCCAAGGTGG - Intronic
983556541 4:169064105-169064127 GCTGTGCAGTGAAGCTAATGGGG + Intergenic
984331481 4:178325893-178325915 ACTGTGGACTGAAGACAAAAGGG + Intergenic
985657781 5:1140919-1140941 GTTGGGGGCTGCAGCCAAGGTGG + Intergenic
985753424 5:1697416-1697438 GTTCTGGACTAAAGTCAAGGTGG - Intergenic
985885048 5:2671085-2671107 GCTGTGGGCTGAAGACAGGAGGG - Intergenic
985955006 5:3258161-3258183 GCTGTCCTCTGAAGCCATGGCGG + Intergenic
986494317 5:8327220-8327242 GCTTTGGACTCAAGCAGAGGGGG + Intergenic
986635740 5:9820698-9820720 GCTGTGAACTGAAGCCTGGTTGG - Intergenic
986707535 5:10463976-10463998 GCTGTGGCCTGCATCCTAGGTGG - Intronic
989669257 5:43895499-43895521 GCTCTGAACTGAAGCAATGGGGG - Intergenic
990799356 5:59582963-59582985 GCTGTGGAATGCTGCCATGGAGG - Intronic
991956996 5:72004976-72004998 GCTGTGGAGGGGAGCCAAGAAGG - Intergenic
995044267 5:107626619-107626641 GCTGTGGACAGAAGCCTTGTTGG + Intronic
996969432 5:129345677-129345699 CCTATGATCTGAAGCCAAGGAGG + Intergenic
997224993 5:132203211-132203233 GCTGTGGACTGAAGACCCAGGGG + Intronic
999051627 5:148529871-148529893 GCTGGGAACTGGAGCAAAGGTGG + Intronic
999366582 5:151027570-151027592 GCTGTGGGCTGGAGCCAGGAGGG - Intronic
999519289 5:152333956-152333978 GCTGTTGAATGAAGCAAAGAAGG - Intergenic
1002194405 5:177494502-177494524 GCTGTGGGCTGAGCCCGAGGTGG + Intronic
1002704473 5:181151029-181151051 GCTGTGGAGTGAAAGCAAGCAGG + Intergenic
1005077781 6:21925554-21925576 GCTTGGGACTGAAGACAAGCAGG - Intergenic
1005358535 6:25008443-25008465 GCTGTGGCCACAAGCGAAGGTGG + Intronic
1006911712 6:37567496-37567518 GCTGTAGACTGAGGCCAAGAAGG + Intergenic
1009905415 6:69865319-69865341 ACTGTGGAAAGAGGCCAAGGAGG - Intergenic
1014789985 6:125661546-125661568 GATGTGCAGTGAAACCAAGGAGG - Intergenic
1015891401 6:137973297-137973319 ACTCTTGGCTGAAGCCAAGGAGG - Intergenic
1019776841 7:2916648-2916670 CCCGTGGACAAAAGCCAAGGGGG - Intronic
1022411997 7:30146307-30146329 GCTGTGGTGAGAAGCCAAGCAGG - Intronic
1022970407 7:35511699-35511721 GGTGTGAGCTGAAGCCAAGGAGG + Intergenic
1023093908 7:36640951-36640973 GCTGTGCACAGGAGCCGAGGGGG + Intronic
1023135634 7:37049176-37049198 GCTGTGTCCTGAGTCCAAGGTGG - Intronic
1023736235 7:43238331-43238353 GCTGGGTCCTGGAGCCAAGGTGG - Intronic
1025084033 7:56008262-56008284 GCTGTGGCCTGAACATAAGGTGG - Intergenic
1025735098 7:64139899-64139921 GTTGTGGACTGAAGTCAGGCAGG + Intronic
1026115106 7:67489416-67489438 GATGAGGACTGGACCCAAGGTGG - Intergenic
1026160750 7:67866663-67866685 GTTGTGGACTGAAGCCAGGCAGG + Intergenic
1026663124 7:72319755-72319777 GATGTCCACTGAAGGCAAGGGGG + Intronic
1026793169 7:73348405-73348427 GATGTGGACGGAAGCCTAGAAGG - Intronic
1029228201 7:99044062-99044084 ACTGGGGAGGGAAGCCAAGGCGG + Intronic
1030083396 7:105797225-105797247 GCTCTGGGCTGTAGCCAGGGAGG - Intronic
1031759609 7:125695663-125695685 GCTGGGGAATGAATTCAAGGAGG + Intergenic
1032887309 7:136154620-136154642 GCTGAGGACAAAGGCCAAGGTGG + Intergenic
1034001330 7:147416300-147416322 GCCTTGGACTGAAGACAAAGTGG + Intronic
1034901037 7:154907921-154907943 GCTGAGGAGTGCAGCCCAGGAGG - Intergenic
1035925646 8:3725164-3725186 GCTGTGCCCTGAAGGCAAGGAGG + Intronic
1036834931 8:12054798-12054820 CCTGTGGAATGCAGCCAAAGTGG + Intergenic
1036856774 8:12301362-12301384 CCTGTGGAATGCAGCCAAAGTGG + Intergenic
1037579944 8:20239127-20239149 GCTGTGGACAGAAGTCACAGTGG - Intergenic
1037682524 8:21109423-21109445 TCTGTGGACTCCAGCCCAGGGGG + Intergenic
1038800581 8:30745104-30745126 GCTTTGGACAGAAGCTATGGTGG + Intronic
1039203110 8:35118570-35118592 GCCGTTGACTGAAGATAAGGAGG + Intergenic
1039776790 8:40745024-40745046 GCAGAGGCATGAAGCCAAGGGGG + Intronic
1039920036 8:41887031-41887053 GCTGTGGACTAGAGCCAAGTAGG - Intronic
1041051500 8:53939209-53939231 CCTGTGGCCTGAACCAAAGGGGG - Intronic
1041717780 8:60947888-60947910 GCTGTGAACTGAAGAAGAGGGGG - Intergenic
1043530222 8:81141654-81141676 GTTGTGGGCTGAAGAAAAGGAGG + Intergenic
1044549695 8:93498025-93498047 TCTGTGGGTTGAAGCCTAGGTGG - Intergenic
1048580958 8:135729467-135729489 GCTGTGGGGTGGAGCCAGGGTGG + Intergenic
1049270961 8:141696074-141696096 GCTGAGGCCTGAGGCCAGGGAGG + Intergenic
1049465823 8:142750874-142750896 GCTGTGCACTGGGGCCAAGCTGG + Intronic
1050715989 9:8526177-8526199 GTTCTGGACCAAAGCCAAGGTGG - Intronic
1056643242 9:88388509-88388531 CCTGTGGACTGCAGCCTCGGCGG + Exonic
1057744299 9:97739352-97739374 GCTGAGGACTGCTCCCAAGGAGG - Intergenic
1059046584 9:110875442-110875464 GCTGTGAACTCCAGCCAAGATGG + Exonic
1060215266 9:121735213-121735235 GGTGTGGACTGATGCAAATGTGG + Intronic
1060488601 9:124065454-124065476 GCTGGGGCCTGCAGCCCAGGTGG + Intergenic
1061150119 9:128823597-128823619 GCTGTGGCAAGAGGCCAAGGGGG + Intronic
1061724837 9:132576472-132576494 GCCATGGACTGAAGCCAGTGGGG - Intergenic
1062071374 9:134556745-134556767 CCTGTGGACTGCAGCCCAGATGG + Intergenic
1185922764 X:4112526-4112548 ACTGAGGACAGAAGCAAAGGGGG + Intergenic
1186233098 X:7477458-7477480 GCCGTGGACTGAAGCTGAGTAGG - Intergenic
1187501127 X:19839658-19839680 GCTGTGGCCAGAAGGCAAGGAGG - Intronic
1191122962 X:56925433-56925455 GATGTGGGCTGAAAACAAGGCGG + Intergenic
1192554849 X:72081291-72081313 GCTGAGGTCTGTAGACAAGGAGG + Intergenic
1193311482 X:80015311-80015333 GGTGAGGACTGAAGCCAACGTGG + Intronic
1195026693 X:100884640-100884662 GAGGTGGGCTGAAGCCAAAGTGG + Intergenic
1199855325 X:151754749-151754771 GATGTGGACTGAGGGCTAGGTGG + Intergenic