ID: 928328497

View in Genome Browser
Species Human (GRCh38)
Location 2:30338820-30338842
Sequence GACAGGAGTGAGGTCATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928328487_928328497 21 Left 928328487 2:30338776-30338798 CCGGGCCAGGGAGGAAGGGGAGG No data
Right 928328497 2:30338820-30338842 GACAGGAGTGAGGTCATGGAAGG No data
928328490_928328497 16 Left 928328490 2:30338781-30338803 CCAGGGAGGAAGGGGAGGGTTTC No data
Right 928328497 2:30338820-30338842 GACAGGAGTGAGGTCATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928328497 Original CRISPR GACAGGAGTGAGGTCATGGA AGG Intergenic