ID: 928330459

View in Genome Browser
Species Human (GRCh38)
Location 2:30354275-30354297
Sequence CAGCTGTGCTAGAAGACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928330459_928330462 16 Left 928330459 2:30354275-30354297 CCAACTGTCTTCTAGCACAGCTG No data
Right 928330462 2:30354314-30354336 AGAAGTTATCGATTTGTCCAAGG No data
928330459_928330465 30 Left 928330459 2:30354275-30354297 CCAACTGTCTTCTAGCACAGCTG No data
Right 928330465 2:30354328-30354350 TGTCCAAGGTGGCAGTCAGTGGG No data
928330459_928330463 19 Left 928330459 2:30354275-30354297 CCAACTGTCTTCTAGCACAGCTG No data
Right 928330463 2:30354317-30354339 AGTTATCGATTTGTCCAAGGTGG No data
928330459_928330464 29 Left 928330459 2:30354275-30354297 CCAACTGTCTTCTAGCACAGCTG No data
Right 928330464 2:30354327-30354349 TTGTCCAAGGTGGCAGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928330459 Original CRISPR CAGCTGTGCTAGAAGACAGT TGG (reversed) Intergenic
No off target data available for this crispr