ID: 928331313

View in Genome Browser
Species Human (GRCh38)
Location 2:30360025-30360047
Sequence GAGTGTGGACAGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928331306_928331313 13 Left 928331306 2:30359989-30360011 CCTGCCGTGGTTATCAGCTGAAG No data
Right 928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG No data
928331307_928331313 9 Left 928331307 2:30359993-30360015 CCGTGGTTATCAGCTGAAGCTGA No data
Right 928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG No data
928331303_928331313 27 Left 928331303 2:30359975-30359997 CCCTCTCACAAGCGCCTGCCGTG No data
Right 928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG No data
928331304_928331313 26 Left 928331304 2:30359976-30359998 CCTCTCACAAGCGCCTGCCGTGG No data
Right 928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928331313 Original CRISPR GAGTGTGGACAGAGGGCAGA GGG Intergenic
No off target data available for this crispr