ID: 928334988

View in Genome Browser
Species Human (GRCh38)
Location 2:30390326-30390348
Sequence TAGCCATGGCTCCCACTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928334988_928334990 -7 Left 928334988 2:30390326-30390348 CCAGTCAGTGGGAGCCATGGCTA No data
Right 928334990 2:30390342-30390364 ATGGCTAAATCTTCCCACTGTGG No data
928334988_928334995 22 Left 928334988 2:30390326-30390348 CCAGTCAGTGGGAGCCATGGCTA No data
Right 928334995 2:30390371-30390393 GACTTCCTCTCCCTCCCTGGAGG No data
928334988_928334999 27 Left 928334988 2:30390326-30390348 CCAGTCAGTGGGAGCCATGGCTA No data
Right 928334999 2:30390376-30390398 CCTCTCCCTCCCTGGAGGGGTGG No data
928334988_928334991 0 Left 928334988 2:30390326-30390348 CCAGTCAGTGGGAGCCATGGCTA No data
Right 928334991 2:30390349-30390371 AATCTTCCCACTGTGGACTCAGG No data
928334988_928334997 24 Left 928334988 2:30390326-30390348 CCAGTCAGTGGGAGCCATGGCTA No data
Right 928334997 2:30390373-30390395 CTTCCTCTCCCTCCCTGGAGGGG No data
928334988_928334996 23 Left 928334988 2:30390326-30390348 CCAGTCAGTGGGAGCCATGGCTA No data
Right 928334996 2:30390372-30390394 ACTTCCTCTCCCTCCCTGGAGGG No data
928334988_928334994 19 Left 928334988 2:30390326-30390348 CCAGTCAGTGGGAGCCATGGCTA No data
Right 928334994 2:30390368-30390390 CAGGACTTCCTCTCCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928334988 Original CRISPR TAGCCATGGCTCCCACTGAC TGG (reversed) Intergenic
No off target data available for this crispr