ID: 928336096

View in Genome Browser
Species Human (GRCh38)
Location 2:30399855-30399877
Sequence CCCACCCAGTTTTAAACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928336096_928336107 22 Left 928336096 2:30399855-30399877 CCCCAGGTTTAAAACTGGGTGGG No data
Right 928336107 2:30399900-30399922 GAGAAGATCAGTGGACTGAAGGG No data
928336096_928336106 21 Left 928336096 2:30399855-30399877 CCCCAGGTTTAAAACTGGGTGGG No data
Right 928336106 2:30399899-30399921 GGAGAAGATCAGTGGACTGAAGG No data
928336096_928336108 30 Left 928336096 2:30399855-30399877 CCCCAGGTTTAAAACTGGGTGGG No data
Right 928336108 2:30399908-30399930 CAGTGGACTGAAGGGATGTTAGG No data
928336096_928336102 -7 Left 928336096 2:30399855-30399877 CCCCAGGTTTAAAACTGGGTGGG No data
Right 928336102 2:30399871-30399893 GGGTGGGAGTGGAATAAGGCAGG No data
928336096_928336104 13 Left 928336096 2:30399855-30399877 CCCCAGGTTTAAAACTGGGTGGG No data
Right 928336104 2:30399891-30399913 AGGATCCTGGAGAAGATCAGTGG No data
928336096_928336103 0 Left 928336096 2:30399855-30399877 CCCCAGGTTTAAAACTGGGTGGG No data
Right 928336103 2:30399878-30399900 AGTGGAATAAGGCAGGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928336096 Original CRISPR CCCACCCAGTTTTAAACCTG GGG (reversed) Intergenic
No off target data available for this crispr