ID: 928336936

View in Genome Browser
Species Human (GRCh38)
Location 2:30406275-30406297
Sequence GACTCACACCCTGCAGGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928336936_928336945 30 Left 928336936 2:30406275-30406297 CCGGCACCTGCAGGGTGTGAGTC No data
Right 928336945 2:30406328-30406350 TTTGGAATCTGAGTCTCCTGTGG No data
928336936_928336940 12 Left 928336936 2:30406275-30406297 CCGGCACCTGCAGGGTGTGAGTC No data
Right 928336940 2:30406310-30406332 CTTCTCTGTGCCCCCATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928336936 Original CRISPR GACTCACACCCTGCAGGTGC CGG (reversed) Intergenic
No off target data available for this crispr