ID: 928338566

View in Genome Browser
Species Human (GRCh38)
Location 2:30421357-30421379
Sequence TGAATACCAAACTCAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928338566_928338567 29 Left 928338566 2:30421357-30421379 CCTGGCTCTGAGTTTGGTATTCA No data
Right 928338567 2:30421409-30421431 GTTTTTTGTCTTAGTTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928338566 Original CRISPR TGAATACCAAACTCAGAGCC AGG (reversed) Intergenic
No off target data available for this crispr