ID: 928338981

View in Genome Browser
Species Human (GRCh38)
Location 2:30425116-30425138
Sequence CTGCATGTAATGATAGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928338981_928338986 -2 Left 928338981 2:30425116-30425138 CCGTGTTCTATCATTACATGCAG No data
Right 928338986 2:30425137-30425159 AGTGGGTGCTGGGTACATCATGG No data
928338981_928338988 26 Left 928338981 2:30425116-30425138 CCGTGTTCTATCATTACATGCAG No data
Right 928338988 2:30425165-30425187 GTCATCTGAACTAAAGTGAGAGG No data
928338981_928338987 -1 Left 928338981 2:30425116-30425138 CCGTGTTCTATCATTACATGCAG No data
Right 928338987 2:30425138-30425160 GTGGGTGCTGGGTACATCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928338981 Original CRISPR CTGCATGTAATGATAGAACA CGG (reversed) Intergenic
No off target data available for this crispr