ID: 928341731

View in Genome Browser
Species Human (GRCh38)
Location 2:30448653-30448675
Sequence CCCCCACCAGGTCTTTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928341726_928341731 15 Left 928341726 2:30448615-30448637 CCTACTTTTTAATTTGAACACAT 0: 1
1: 0
2: 3
3: 60
4: 633
Right 928341731 2:30448653-30448675 CCCCCACCAGGTCTTTAGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928341731 Original CRISPR CCCCCACCAGGTCTTTAGGC TGG Intronic
902156844 1:14494532-14494554 CCCCCTTCAGGTCAATAGGCAGG + Intergenic
913666975 1:121057660-121057682 ACCACACCAGGTCTTCAGCCAGG - Intergenic
914018720 1:143845084-143845106 ACCACACCAGGTCTTCAGCCAGG - Intergenic
914432547 1:147632051-147632073 CCCACACCAGTTCTTTGGCCTGG + Intronic
914657273 1:149753287-149753309 ACCACACCAGGTCTTCAGCCAGG - Intergenic
922450927 1:225736648-225736670 TCCCCACCAGGGCTGTAGCCGGG - Intergenic
1062828759 10:590946-590968 CCCCCACCAGGTTCTTCTGCCGG + Intronic
1067553192 10:47249296-47249318 CTCCCACCATGGCTTTGGGCTGG + Intergenic
1070678271 10:78430463-78430485 CTCACACCAGGTCTATAGGTGGG - Intergenic
1085328665 11:75628401-75628423 CCCCCAGCAGGTGTTTAAGCTGG - Intronic
1087709183 11:101530119-101530141 CTCCCAGCAGGTCTCTGGGCAGG - Intronic
1088564408 11:111152902-111152924 CCCCAACCAGGTCTTTGTGCTGG + Intergenic
1090461558 11:126895724-126895746 CCCCCACCAGCTCCAGAGGCTGG - Intronic
1096801790 12:54115327-54115349 CCACCACCAGAGCTTCAGGCAGG + Intergenic
1101080121 12:101173283-101173305 CCTGCACCAGGTCTTTGAGCAGG + Intronic
1101897459 12:108767403-108767425 CGCCCATCAGTTCTTTAGTCTGG + Intergenic
1102787290 12:115614970-115614992 CCCCCATCAGGGCTCTGGGCAGG - Intergenic
1117602123 14:57386839-57386861 CCCTGACCATGTCTTCAGGCAGG + Intergenic
1118460683 14:65984249-65984271 TCCCCACCATGTCTTGAGGTTGG - Intronic
1122810152 14:104283727-104283749 CCCCCACCAGCTCTGCAGGGAGG - Intergenic
1123766568 15:23484931-23484953 CTCCCAGCAGGTCTTTAAGCTGG - Intergenic
1124884711 15:33674485-33674507 TCCTCACCAGGTCTTAATGCAGG + Intronic
1132652381 16:1027407-1027429 CCCCCACGGGGTCTTTGGGCAGG - Intergenic
1133383016 16:5346858-5346880 CCCACACCAGCTCTTGAGGGAGG - Intergenic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1134851380 16:17481727-17481749 CCCCCACCAAGTCTCTGGGGTGG + Intergenic
1141795452 16:86270413-86270435 CCCCCATCAGATCCTTAGGCTGG - Intergenic
1142262431 16:89049225-89049247 CCCCCACCAGGTCATGTGGGCGG - Intergenic
1143040691 17:4034034-4034056 CACCCACCTGCTCTTTAGCCTGG - Exonic
1144095288 17:11894775-11894797 CACCTACCAGGGCTTAAGGCTGG + Intronic
1152240378 17:79157719-79157741 CCACCACCACCTCTTAAGGCTGG + Intronic
1152260388 17:79263586-79263608 CCCCCACCTGCTCTCTAGGGTGG + Intronic
1156601541 18:38613005-38613027 CTCCCACCAGGTTTTTCTGCTGG - Intergenic
1160969778 19:1762434-1762456 CCCCCAGCAGGTCCTTGGACGGG - Intronic
1162156197 19:8679459-8679481 CCCCCACCAGATCTGGGGGCTGG + Intergenic
1162506725 19:11090221-11090243 CCCCCAGAAGGACTTAAGGCGGG - Intronic
1162533905 19:11252157-11252179 CCCCCGCCAGGTCTTTGAGCAGG - Exonic
1166992914 19:46704096-46704118 CCCCAACCTGGTCTTGTGGCAGG - Intronic
1167116696 19:47492795-47492817 CCCCCACCCTGTCTTCAGCCTGG - Intronic
928341731 2:30448653-30448675 CCCCCACCAGGTCTTTAGGCTGG + Intronic
932681666 2:73830883-73830905 CCCTCACCCGGTCTTCGGGCGGG - Exonic
1169491622 20:6076168-6076190 CCCCCACAGGGGCTTTAGGCTGG - Exonic
1171794919 20:29559139-29559161 CCACCACCAGAGCTTCAGGCAGG - Intergenic
1171853535 20:30325126-30325148 CCACCACCAGAGCTTCAGGCAGG + Intergenic
1174168345 20:48600351-48600373 CACCCACCAGGCCTCTTGGCAGG - Intergenic
1174658959 20:52194020-52194042 CTCCCACCAGTTCCTCAGGCTGG - Intronic
1174827092 20:53778235-53778257 CACCTGCCAGGTCTCTAGGCTGG + Intergenic
1180844663 22:18974605-18974627 CACCCACCAGGTCTAGGGGCTGG + Intergenic
1182424279 22:30263951-30263973 CCCCCACCAGGCCCTGAGGAAGG - Exonic
1184893714 22:47394792-47394814 TCTCCACCAGTTCTTGAGGCTGG - Intergenic
953636808 3:44671141-44671163 CCCCCACCAGGGCTAAGGGCTGG + Intergenic
954663328 3:52237597-52237619 CCTCCACCAGGGCTGGAGGCTGG + Intronic
959621504 3:108403165-108403187 CCCCCAACAGGCCTCCAGGCTGG + Intronic
960149222 3:114233049-114233071 CCCCCACACGGCCTTTATGCTGG + Intergenic
961639049 3:128353469-128353491 CCCCCACCAGGTTATTTGGAAGG - Intronic
961740573 3:129030979-129031001 CTCCCACCAGGTGCTCAGGCTGG + Intronic
970408196 4:15783486-15783508 CCCCCACCTTGTCTTGGGGCAGG - Intronic
975652983 4:76613104-76613126 CCCCCACCAACTCGTTATGCTGG - Intronic
979625645 4:122842169-122842191 CCCCCAACAGGTCTTTAGAAAGG - Intronic
984192301 4:176620228-176620250 CCCCCACTAGCTCCTCAGGCTGG + Intergenic
986479865 5:8176019-8176041 CCCCCACAAGGTAGTTAGGAAGG - Intergenic
1001529543 5:172452683-172452705 CTCCCACCAGGTCTGTGAGCTGG - Intronic
1006459453 6:34149927-34149949 CCCCCACCAAGGCACTAGGCAGG - Intronic
1007476323 6:42122225-42122247 CCTCCACCAGGTATTATGGCGGG + Intronic
1012433778 6:99193242-99193264 CCCCCAGCAAGTCCTTAGCCTGG + Intergenic
1014906461 6:127035289-127035311 CCCCCACCAGGAATGTGGGCTGG - Intergenic
1028896627 7:96048629-96048651 GCCCCACCAGCTCTGTAGGATGG - Intronic
1032052082 7:128655983-128656005 GACCCCCCAGGTGTTTAGGCAGG + Intergenic
1044863464 8:96546143-96546165 CCACCATCAGGTCTTTAGAGGGG - Intronic
1046820566 8:118630062-118630084 CCCTCACCAGGTCTTTTTGAGGG + Intergenic
1053121943 9:35554099-35554121 CTTTCACCAGGGCTTTAGGCCGG + Intronic
1057821536 9:98335037-98335059 TCCACACCAGAACTTTAGGCAGG - Intronic
1058902354 9:109453009-109453031 CCCATACCAGCTCTTTATGCTGG - Intronic
1060831824 9:126722351-126722373 CCCCAACCTGGTCTCCAGGCAGG + Intergenic
1061574019 9:131495124-131495146 CCCCCACCAGGTCTGAACTCTGG - Intronic
1189332003 X:40149940-40149962 CCATCACCAGGCCTTTAGGCGGG - Intronic
1191004584 X:55697571-55697593 CCACCACCAGGATTTAAGGCAGG - Intergenic
1194262767 X:91717232-91717254 CGGCCACCAGGCCTCTAGGCTGG - Intergenic
1197162817 X:123343240-123343262 CCACCACCAGGTTTTTATCCAGG + Intronic
1197854654 X:130902445-130902467 CCCCCACCAGGTCTTTGAAGTGG - Intronic