ID: 928347674

View in Genome Browser
Species Human (GRCh38)
Location 2:30516323-30516345
Sequence CGACGTTCAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 4, 2: 9, 3: 28, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928347674_928347680 13 Left 928347674 2:30516323-30516345 CCGTCCACCACTGCTGAACGTCG 0: 1
1: 4
2: 9
3: 28
4: 152
Right 928347680 2:30516359-30516381 GCCATTGACTTTCACCGCTCTGG 0: 1
1: 1
2: 10
3: 42
4: 126
928347674_928347683 24 Left 928347674 2:30516323-30516345 CCGTCCACCACTGCTGAACGTCG 0: 1
1: 4
2: 9
3: 28
4: 152
Right 928347683 2:30516370-30516392 TCACCGCTCTGGATCCGGCAAGG 0: 1
1: 0
2: 17
3: 71
4: 166
928347674_928347682 19 Left 928347674 2:30516323-30516345 CCGTCCACCACTGCTGAACGTCG 0: 1
1: 4
2: 9
3: 28
4: 152
Right 928347682 2:30516365-30516387 GACTTTCACCGCTCTGGATCCGG 0: 1
1: 2
2: 35
3: 79
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928347674 Original CRISPR CGACGTTCAGCAGTGGTGGA CGG (reversed) Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924371587 1:243356668-243356690 CGACAATCAGCAGTGGTTGTAGG - Intronic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1069918142 10:71799625-71799647 CCACGGTGAGCAGTGATGGAGGG + Exonic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1074440677 10:113475035-113475057 GAAATTTCAGCAGTGGTGGAGGG + Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075524949 10:123176159-123176181 CCACCTTCAGAAATGGTGGAGGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077510216 11:2955936-2955958 CCAGCTTCAGAAGTGGTGGATGG - Intronic
1077775789 11:5270071-5270093 AGAGGGTCAGCAGTGATGGATGG + Exonic
1081063030 11:38503995-38504017 CCACAATCAGCAGTGGGGGATGG - Intergenic
1082737600 11:56873900-56873922 CGATGATCGGCAGTGGTGGATGG - Intergenic
1082888040 11:58109100-58109122 CGAGCTTCAGCAGGGGTGGGAGG + Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085202642 11:74710985-74711007 TGAGGTTCTGCAGTGGGGGAGGG + Exonic
1085900977 11:80699570-80699592 CAGTGCTCAGCAGTGGTGGACGG + Intergenic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1089914914 11:122144432-122144454 TGAATTTCAGCAGTAGTGGATGG - Intergenic
1092020304 12:5196872-5196894 AGATGTTCAGCTGTGGTTGATGG - Intergenic
1095284196 12:40389168-40389190 TGGCATTCAGCAGTGGTTGATGG - Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1097699602 12:62806698-62806720 AAACGTTCAGTCGTGGTGGAAGG - Intronic
1098077946 12:66753447-66753469 AGCAGGTCAGCAGTGGTGGAAGG - Intronic
1098848655 12:75568400-75568422 AGACATTCAGCTGTGGTGGAAGG - Intergenic
1103802552 12:123548793-123548815 TGGTGATCAGCAGTGGTGGATGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104808909 12:131608207-131608229 CGGATTCCAGCAGTGGTGGAGGG + Intergenic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG + Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1120341435 14:83225694-83225716 TGTCATTCAGCAGTGGTCGACGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1139911093 16:70398191-70398213 GGACGTCCAGAGGTGGTGGATGG - Exonic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1145954085 17:28842664-28842686 CGACCGTGAGTAGTGGTGGAGGG - Exonic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1152310341 17:79546174-79546196 TGTCGTTCATCAGTGGTGGCAGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
926222461 2:10945068-10945090 CGACGGGCAGCAGTGAGGGAGGG + Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928347674 2:30516323-30516345 CGACGTTCAGCAGTGGTGGACGG - Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932176042 2:69603514-69603536 CGACCTTCTGCAGTGATGGCTGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
935337660 2:102031988-102032010 CGAAGTTATCCAGTGGTGGATGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
946020320 2:216635931-216635953 GGATGTTAAGCAGGGGTGGAAGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
954127285 3:48539000-48539022 GCACCTTCAGCAGGGGTGGAAGG - Intronic
957895103 3:86411956-86411978 TGGCGTTCAGCAGGGGTGGACGG - Intergenic
959885721 3:111497404-111497426 TGGCGTTCAGCCATGGTGGATGG + Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
962677288 3:137766424-137766446 CGACTTTAAGCAGTGATGGCTGG + Intergenic
963117605 3:141745183-141745205 GGACATGCAGCAGTTGTGGAAGG - Exonic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
964154014 3:153563295-153563317 AAACTTTCAACAGTGGTGGAAGG - Intergenic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969175981 4:5399416-5399438 CTATGTACAGGAGTGGTGGATGG + Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
971076770 4:23158374-23158396 CAGCGTACAGCAGGGGTGGATGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
990129785 5:52566727-52566749 TGATCTTCAGGAGTGGTGGAAGG + Intergenic
990905177 5:60795614-60795636 CGGCATTCAGCCCTGGTGGATGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
1003839353 6:10104282-10104304 AGACACTCAGCAGTGGTGCAGGG - Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009885202 6:69617025-69617047 GGGTGATCAGCAGTGGTGGACGG - Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013410504 6:109879599-109879621 TGGTGATCAGCAGTGGTGGACGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1026859733 7:73778036-73778058 CGAGGTTCAGGAGTGGAGGAGGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028083054 7:86600871-86600893 TGACGGTCAGCAGGGGTGGGAGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029477306 7:100792586-100792608 GAGCGTTCAGCAGAGGTGGACGG - Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031634906 7:124090848-124090870 CTACCTTCAGCTGGGGTGGAGGG + Intergenic
1031970728 7:128063088-128063110 CGACGTTGAGCAGAGGTGGGAGG - Intronic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035920201 8:3668223-3668245 TGAGATCCAGCAGTGGTGGACGG - Intronic
1036255826 8:7205891-7205913 CTACGTTCTGCAGTAGGGGAAGG - Intergenic
1036361659 8:8081608-8081630 CTACGTTCTGCAGTAGGGGAAGG + Intergenic
1036896912 8:12643564-12643586 CTACGTTCTGCAGTAGGGGAAGG - Intergenic
1037570601 8:20154834-20154856 CAGCGCTCAGCCGTGGTGGACGG - Intronic
1037648693 8:20817066-20817088 TGACCAGCAGCAGTGGTGGATGG + Intergenic
1037830996 8:22188928-22188950 CCACGTGGAGGAGTGGTGGAGGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1041963688 8:63649429-63649451 AGACGTTGAGCAGGGGTGGGAGG - Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045276794 8:100713845-100713867 CGACTTTCAACAGGAGTGGAAGG + Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1053114885 9:35491373-35491395 AGATATTAAGCAGTGGTGGATGG + Intronic
1061990046 9:134153841-134153863 CGACCCTCAGAAGTGGAGGAAGG - Intronic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1185705208 X:2261857-2261879 CCTCGTACAGCACTGGTGGAGGG - Intronic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198862288 X:141084202-141084224 CGGCCTTCGGCGGTGGTGGACGG - Intergenic
1198862295 X:141084226-141084248 CGGCCTTCGGCGGTGGTGGACGG - Intergenic
1198862308 X:141084274-141084296 CGGCCTTCGGCGGTGGTGGACGG - Intergenic
1198862326 X:141084345-141084367 CGGCGTTCAGCGGTGGTGGACGG - Intergenic
1198900368 X:141503041-141503063 CGGCGTTCAGCGGTGGTGGACGG + Intergenic
1198900382 X:141503098-141503120 CGGCCTTCGGCGGTGGTGGACGG + Intergenic
1198900395 X:141503146-141503168 CGGCCTTCGGCGGTGGTGGACGG + Intergenic
1198900402 X:141503170-141503192 CGGCCTTCGGCGGTGGTGGACGG + Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200415982 Y:2910352-2910374 CGGCGATCAGCAGTGGTGAACGG + Intronic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic