ID: 928348185

View in Genome Browser
Species Human (GRCh38)
Location 2:30519878-30519900
Sequence TGGCATTCAGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 2, 1: 7, 2: 61, 3: 116, 4: 312}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
928348185_928348188 -9 Left 928348185 2:30519878-30519900 CCATCCACCACTGCTGAATGCCA 0: 2
1: 7
2: 61
3: 116
4: 312
Right 928348188 2:30519892-30519914 TGAATGCCACCTTCTCAGACTGG 0: 1
1: 0
2: 5
3: 56
4: 334
928348185_928348191 13 Left 928348185 2:30519878-30519900 CCATCCACCACTGCTGAATGCCA 0: 2
1: 7
2: 61
3: 116
4: 312
Right 928348191 2:30519914-30519936 GCCATTGACTTTCACCCCTCTGG 0: 1
1: 11
2: 33
3: 88
4: 174
928348185_928348193 19 Left 928348185 2:30519878-30519900 CCATCCACCACTGCTGAATGCCA 0: 2
1: 7
2: 61
3: 116
4: 312
Right 928348193 2:30519920-30519942 GACTTTCACCCCTCTGGATCTGG 0: 2
1: 33
2: 76
3: 91
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
928348185 Original CRISPR TGGCATTCAGCAGTGGTGGA TGG (reversed) Intronic
901152618 1:7113997-7114019 TGGGTTACAGCAGTGGTGGGAGG - Intronic
903350322 1:22712885-22712907 TTGCAGTCAGCGGTGCTGGAGGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910173357 1:84401512-84401534 TGGGCTTCAGGAGAGGTGGAAGG - Intronic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
914428748 1:147600656-147600678 TGGGATGCAGGAGTGTTGGAGGG + Intronic
915361104 1:155286848-155286870 TGGGATTGAGCAGTCGGGGAGGG + Intronic
915831095 1:159130991-159131013 TGGCATTAAGCTGTGAAGGAAGG - Intronic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917215567 1:172674856-172674878 TGGCAAGCAGCACTGGAGGAGGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917413365 1:174783068-174783090 TAGCATTCAGCAGTGATGAACGG - Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918367159 1:183820521-183820543 TGGAATTCAGCTGGAGTGGATGG + Intronic
918878773 1:190085823-190085845 TTGCATTCAGCAAGTGTGGAAGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921781278 1:219167755-219167777 TGTCATTGAGCTGTGGTAGAAGG - Intergenic
922597055 1:226822194-226822216 CTGCACTCAGCAGTGGTGGGAGG - Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1065860394 10:29867584-29867606 TGGAATTCCGCAGTGGAGTATGG - Intergenic
1065960879 10:30732975-30732997 TGGCATTCAGGACTGGTGGCGGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066423908 10:35287490-35287512 TTGGATTCAGGAATGGTGGAAGG - Intronic
1067552837 10:47247319-47247341 AGGCACCCAGCAGTGGAGGAGGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069798980 10:71070629-71070651 TGGCAGTGAGCAGGGGTGGTGGG - Intergenic
1070583391 10:77742037-77742059 GGCCACTCAGCAGTGGTGGTAGG + Intergenic
1070674105 10:78400112-78400134 TGGCATACAGCAGCAGTGGTGGG - Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071529932 10:86381339-86381361 TGGATTTCAGCAGTTGGGGAGGG - Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1072905722 10:99451395-99451417 AGGCATTTAGCAGAGATGGAGGG + Intergenic
1074761221 10:116668851-116668873 TGGCTGTCAGAAGTGGGGGATGG + Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075970046 10:126644293-126644315 TGGAGTTCTGCAGTGGAGGAGGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077361602 11:2143217-2143239 TGACACTCAGCAGGGCTGGAAGG - Intronic
1077606608 11:3616746-3616768 TGGCATCCAGGAGTGGAGGTGGG - Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080165517 11:29231723-29231745 TGGTATTCAGTATTTGTGGAAGG - Intergenic
1080564560 11:33496257-33496279 TGGCATTCTTAAGTGGTGGCTGG - Intergenic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1083222115 11:61259239-61259261 TGGCATTCAGCAAAGCTGGTCGG - Exonic
1083969120 11:66061905-66061927 TGGCAATCAGCCATGGGGGAGGG - Exonic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085198242 11:74684965-74684987 TGGGATTGAACAGGGGTGGAGGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086063551 11:82724053-82724075 TGGTATCCAGCAGTGGAGGGAGG - Intergenic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089642534 11:119857163-119857185 TGCCAGGCAGCAGAGGTGGAAGG + Intergenic
1089914914 11:122144432-122144454 TGAATTTCAGCAGTAGTGGATGG - Intergenic
1092293641 12:7181266-7181288 TGGTGATCAGCAATGGTGGACGG - Intergenic
1092709046 12:11315062-11315084 TGGGTATCAGCAGTGGTGGCTGG - Intergenic
1092953082 12:13525975-13525997 TGGAATTCAGCAGTGGGAAATGG + Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094479166 12:30867018-30867040 TGGCACTCATCAGTGGAGAAAGG - Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095284196 12:40389168-40389190 TGGCATTCAGCAGTGGTTGATGG - Intergenic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1095923499 12:47555408-47555430 TGGCTTTGAGCAGTATTGGAGGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096414579 12:51402240-51402262 TGGGATTCAGCTGTTGTTGAAGG + Intronic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098786521 12:74764874-74764896 TTGCACTCAGCTGTGTTGGAGGG + Intergenic
1098848655 12:75568400-75568422 AGACATTCAGCTGTGGTGGAAGG - Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099197794 12:79639733-79639755 TGGCAATTAGCAGTAGTGGCTGG + Intronic
1099295690 12:80825337-80825359 TGGGATTCTGCAGTGGCAGAAGG - Intronic
1103802552 12:123548793-123548815 TGGTGATCAGCAGTGGTGGATGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104087772 12:125492329-125492351 TGGCATGCAGCAGTGTTTGGAGG - Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104396035 12:128434052-128434074 TGGCATCCAGCTCTTGTGGATGG - Intronic
1104485537 12:129148749-129148771 TGGCATGCAGCTGTGGAGGAGGG - Intronic
1104808909 12:131608207-131608229 CGGATTCCAGCAGTGGTGGAGGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1105836648 13:24217893-24217915 TGGCAGTGGGCAGTGGTGGTGGG - Intronic
1107291912 13:38864152-38864174 TGCCATACAGCAGTGGTGTATGG - Intronic
1108158794 13:47616496-47616518 TGGCATTTAGCAGGTGTGGATGG + Intergenic
1108834219 13:54520869-54520891 TGTCATTCAGCGGTGGGAGAGGG - Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109393506 13:61724305-61724327 TAGCATTCAGCAGTGGGTGTGGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112234779 13:97625406-97625428 TGGGAAGCAGCACTGGTGGATGG - Intergenic
1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115232242 14:31173598-31173620 TTGGAATCTGCAGTGGTGGATGG + Exonic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119142733 14:72282513-72282535 TAGCATTAAGCAGGGGTGGACGG - Intronic
1119700752 14:76752975-76752997 TGGCATTCAGCAATGAGAGAAGG - Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120341435 14:83225694-83225716 TGTCATTCAGCAGTGGTCGACGG - Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1120845329 14:89120059-89120081 TGGTGCTCAGTAGTGGTGGAGGG + Intergenic
1122129816 14:99598531-99598553 TGGCATGGAGGAGTGGGGGAAGG - Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1202894798 14_GL000194v1_random:744-766 TGGCAGGCACCAGTGCTGGAGGG + Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124953661 15:34345841-34345863 AGGCATTCTGCTGTGGGGGAGGG - Intronic
1125711561 15:41791182-41791204 TGGGATTGAGAAGTGGGGGAAGG + Intronic
1126380934 15:48046201-48046223 TGGCAGTCAGCATTGGTCGGAGG - Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127535532 15:59886601-59886623 TGGCTTTCAGCCCTGGTGGGAGG + Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129598595 15:76983795-76983817 TGGCCCTCAGCAGTGGAGGCAGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132076751 15:98827896-98827918 TGGTATTCTGCAGTGGAGAATGG + Intronic
1133231228 16:4367598-4367620 TGGGCCTCAGCAGTGGGGGAAGG + Intronic
1133505194 16:6404918-6404940 TGGAATTCAGCATTGGTAGACGG + Intronic
1134251722 16:12578770-12578792 TGGCATGGAGCAGGGGTGGTAGG - Intergenic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1136379042 16:29883095-29883117 TGGCACTCGGCTGTGATGGATGG - Intronic
1136576736 16:31129780-31129802 TGGCACTCAGAAGGGGTGGCCGG + Intronic
1136686896 16:32000564-32000586 TGGCTTTTAGATGTGGTGGAAGG - Intergenic
1136787504 16:32944111-32944133 TGGCTTTTAGATGTGGTGGAAGG - Intergenic
1136882273 16:33909674-33909696 TGGCTTTTAGATGTGGTGGAAGG + Intergenic
1137721031 16:50627585-50627607 TGGCACTCAGAAGGCGTGGAAGG - Intronic
1138148627 16:54635105-54635127 TGGAATTAAGCAGAGGTGGTAGG + Intergenic
1141359704 16:83384282-83384304 TGGCAGTCAGCAGAGATGGCTGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1203089737 16_KI270728v1_random:1205782-1205804 TGGCTTTTAGATGTGGTGGAAGG - Intergenic
1146604728 17:34248379-34248401 TTACATTAAGCAGTGGTGCAGGG + Intergenic
1147147859 17:38496239-38496261 TGGCTTTTAGATGTGGTGGAAGG - Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148395001 17:47300781-47300803 TGGGAAGCAGAAGTGGTGGATGG - Intronic
1148815564 17:50325589-50325611 AGGGATTCAACAGTGGTGGATGG - Intergenic
1149080595 17:52651843-52651865 TGGGATTCAGCAGAAGAGGAAGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149584968 17:57780356-57780378 AGGCTCTCAGCAGTGGAGGATGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152310341 17:79546174-79546196 TGTCGTTCATCAGTGGTGGCAGG - Intergenic
1152887371 17:82860335-82860357 TGGCCTTTCGCAGTGGTGGAGGG + Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153999531 18:10472037-10472059 TGGCATTCTGCAGAGGGGGCTGG - Exonic
1155745442 18:29351357-29351379 TGCCATGCAGCAGTGGTTAAAGG - Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1155872937 18:31049673-31049695 TAGAATTCAGCAGAGGTGAAAGG - Intergenic
1156523160 18:37739197-37739219 TGGCTTTCAGCAGGGTTGGAAGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG + Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1162007761 19:7790724-7790746 TGGTTCTCAGCAGTGGTGGATGG - Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165690248 19:37857317-37857339 TGGAATGGAGCAGTGGTTGATGG - Intergenic
1165772002 19:38385573-38385595 TGCCTGACAGCAGTGGTGGAGGG - Exonic
1166671279 19:44710854-44710876 TGGCATCCAGCAGTGGGGTGTGG - Intergenic
1167723073 19:51192251-51192273 TGGCATTCAGCAGCTCAGGAAGG + Intergenic
1167825820 19:51972065-51972087 TGGGATTTTGCAGTGGTAGAGGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168437032 19:56326486-56326508 TGGCAGTTACCAGGGGTGGAGGG - Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925249145 2:2415601-2415623 TGGCAGTCAGCACTGGTGAAAGG + Intergenic
926280054 2:11438725-11438747 TGGCATCTAGGAGTGGAGGACGG - Intergenic
927143768 2:20147054-20147076 TGACATTCAATAGTGGGGGAGGG - Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928231361 2:29501240-29501262 TGACATTCAGTAGTGAAGGAAGG - Intronic
928347674 2:30516323-30516345 CGACGTTCAGCAGTGGTGGACGG - Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932056888 2:68454639-68454661 TGGCTTTCAACACTGGAGGAAGG - Intergenic
932411369 2:71549859-71549881 TGGCCTTCAGGAGAGGTGGGAGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933252548 2:80045093-80045115 TGGACTTCAGAAATGGTGGATGG + Intronic
934886280 2:98028369-98028391 TCGCACGCAGCAGGGGTGGAGGG - Intergenic
935089425 2:99880469-99880491 TGGCATTCTGAGGTGGTGGGTGG + Intronic
935147723 2:100407532-100407554 TGCCATGCAGAAGTGATGGATGG - Intronic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937541913 2:122966140-122966162 TGGCCTGAAGCAGTGGGGGAAGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
938979646 2:136514183-136514205 TGGCATGAAGTAATGGTGGAAGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG + Intronic
939674814 2:145059574-145059596 TTGAATTAAGCAGTGGAGGAAGG + Intergenic
940266173 2:151841269-151841291 TGGCATTAAGAAGTAATGGAGGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940721777 2:157290453-157290475 TGGCATTGAGCAGAGATGGCAGG + Intronic
940885817 2:158988520-158988542 CGGCATTTAGCAAAGGTGGAGGG - Intronic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
944125886 2:196292368-196292390 TGCCATTCTGAAGTCGTGGAGGG - Intronic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
1168978106 20:1983017-1983039 AGGCAGTCCGCTGTGGTGGAGGG + Exonic
1169012120 20:2259524-2259546 TGGGCTTCTGCAGTGGTGAATGG + Intergenic
1169465630 20:5835627-5835649 GGGCTTTCAGCAGTGGGGGCTGG + Intronic
1171016935 20:21550315-21550337 TGACATTCAGCAGTAGATGATGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1174305737 20:49613110-49613132 TGGCGGTCAGTAGTGGTGGTCGG + Intergenic
1174352102 20:49975822-49975844 TAGCTGTCAGCAGGGGTGGAAGG - Intergenic
1174382268 20:50163711-50163733 TGGCTTTCAGCTGTGCTGGCTGG + Intergenic
1176614497 21:9016731-9016753 TGGCAGGCACCAGTGCTGGAGGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177797093 21:25790276-25790298 TGGCATACAGCAGCGGGGGAAGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178900804 21:36596989-36597011 TGGCAGGCAGCGGGGGTGGAGGG + Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179913243 21:44461077-44461099 TGGGGTCCAGCAGTGGGGGATGG + Exonic
1180057677 21:45367293-45367315 TGGCAGCCAGCAGTGGGAGAGGG - Intergenic
1180735331 22:18012336-18012358 TGGCAGTCATCAGTGGGGAAAGG + Intronic
1180880315 22:19198773-19198795 TGGCATTCAGCAAGGTTGGCAGG - Intronic
1181117199 22:20639605-20639627 TGGCTTCCAGCAGAGGAGGATGG - Intergenic
949541626 3:5036918-5036940 TGGCATCCAGAAGTGGGGGTTGG + Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950167578 3:10813446-10813468 TGGCATTCAAAAATGGTAGAAGG + Intergenic
950719926 3:14875510-14875532 TGGCATGGAGGAGTGGTGGAGGG + Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953853131 3:46480990-46481012 TGCCTATCAGCAGTGGAGGAGGG - Intronic
954558276 3:51535357-51535379 TGGCATTCAGAAGTGAGGGGGGG + Intergenic
954572853 3:51656609-51656631 GGCCAGTCAGCAGTGGTGGCAGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955774664 3:62420547-62420569 TGGCAGGCAGCACAGGTGGATGG + Intronic
956742859 3:72288678-72288700 TGGTAGTCAGCAGTGGAGGTGGG - Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957113346 3:75993679-75993701 TGTCATTAAGCAGTGATGGTAGG + Intronic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
957895103 3:86411956-86411978 TGGCGTTCAGCAGGGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958733954 3:97988778-97988800 TGGCGTTTGGTAGTGGTGGATGG + Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
959885721 3:111497404-111497426 TGGCGTTCAGCCATGGTGGATGG + Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961714243 3:128847800-128847822 TGGCATTCAGCAGAGGATGGAGG - Intergenic
961905772 3:130261469-130261491 TGGGATACAGCAATGGAGGATGG - Intergenic
962448011 3:135485732-135485754 TGGGATTCAGCAGTAGTAGAGGG - Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963117605 3:141745183-141745205 GGACATGCAGCAGTTGTGGAAGG - Exonic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
965811000 3:172591896-172591918 TGACAAGCAGCAGGGGTGGATGG + Intergenic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
968288378 3:197521277-197521299 TAGAATACAGCAGTGGGGGATGG - Intronic
968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG + Intergenic
969055118 4:4396839-4396861 TGGCATTCAGCAGTGGGGGTGGG + Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
971246871 4:24937220-24937242 TGGAACTCAGGAGGGGTGGAAGG + Intronic
971440144 4:26676830-26676852 TGGCATTCTTCATTTGTGGAGGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974384421 4:61186598-61186620 TGGCATTCAGAAATGGAGCAAGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974563053 4:63546791-63546813 TGGAATTCAGGCCTGGTGGAAGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975980888 4:80157961-80157983 TGGCAGTCAGGAGTGGTGGGAGG - Intergenic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
977081482 4:92534723-92534745 TGGCATTCACCAGTGATGTAAGG - Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
977618439 4:99109817-99109839 TGGCAGCAAACAGTGGTGGACGG + Intergenic
977919114 4:102624348-102624370 TCGCTGGCAGCAGTGGTGGAGGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981310298 4:143291448-143291470 TAGCTTTCAGCAGTGTTGTAAGG - Intergenic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
984924603 4:184795640-184795662 TGGTAATGAGCAGTGGTGGTTGG - Intronic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
986990375 5:13545710-13545732 TGGCAGTCTGCAGTGGTGATGGG - Intergenic
987026927 5:13936843-13936865 TGGCAGCCAGCAGAAGTGGATGG + Intronic
987183605 5:15391422-15391444 TTGCATTTAGAAGTGGGGGATGG + Intergenic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990129785 5:52566727-52566749 TGATCTTCAGGAGTGGTGGAAGG + Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
990905177 5:60795614-60795636 CGGCATTCAGCCCTGGTGGATGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993593851 5:89828110-89828132 TGGCATTCTGCAGTGCGGGTGGG + Intergenic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
995870387 5:116738175-116738197 TGTGTTTCAGCAGTGATGGAAGG + Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997846158 5:137287785-137287807 TTGCATTTAGCAGTAGTGAAGGG - Intronic
1001816143 5:174670945-174670967 TGGCCTTCAGTAGCGGGGGAAGG - Intergenic
1001926424 5:175640452-175640474 TGGGATTCTGCAGGGCTGGAAGG - Intergenic
1001943186 5:175755065-175755087 TGCCATTTAGAAGGGGTGGAAGG - Intergenic
1003839353 6:10104282-10104304 AGACACTCAGCAGTGGTGCAGGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004925964 6:20415412-20415434 GGGCAGTTAACAGTGGTGGAGGG + Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005358865 6:25011141-25011163 TGGCAATGAGCAGTGGAGGGAGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1006338203 6:33431879-33431901 TGGCAGTCAGCAGGGGAGCATGG - Intronic
1006805814 6:36788334-36788356 TGGCTTTGAGCAGTGGAGGTTGG - Intronic
1007081614 6:39109188-39109210 TGGAGGTCAGGAGTGGTGGATGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1009885202 6:69617025-69617047 GGGTGATCAGCAGTGGTGGACGG - Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012310951 6:97723337-97723359 GGGCATTCAGCAGTAGTGACTGG - Intergenic
1012446747 6:99314717-99314739 TGGCATGAGGCAGTGGTGGCAGG - Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013410504 6:109879599-109879621 TGGTGATCAGCAGTGGTGGACGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018137630 6:160792894-160792916 TGGCATTCAGAAGTGGAAGCTGG - Intergenic
1018762957 6:166906836-166906858 GGGCATGCAGCAGCGGTGGGTGG - Intronic
1019055516 6:169220393-169220415 AAGCATTCACCAGTGATGGAAGG + Intronic
1019308461 7:347441-347463 TGGAGGTCAGCATTGGTGGAGGG - Intergenic
1019779236 7:2929850-2929872 TGGCATTCTGCAGGGGGAGAGGG + Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021057456 7:16067647-16067669 TGACATTCAGCTGGGGTGGGAGG + Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023241415 7:38151536-38151558 TGGCAGTTAGCAGGAGTGGAGGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024156766 7:46633986-46634008 AGGCAATGAGCAGTGGAGGAAGG - Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1027164979 7:75827947-75827969 TTGAATTCAGCCGTGGTGGGAGG - Intergenic
1027319939 7:77004933-77004955 TGGCCTTCAGCAATGGTGCGGGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028700578 7:93774342-93774364 AGGCATTCAGCATTGGTATAAGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029477306 7:100792586-100792608 GAGCGTTCAGCAGAGGTGGACGG - Intronic
1029959621 7:104675877-104675899 TTGCATCCAGCAGTTTTGGAGGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032087134 7:128890447-128890469 TGGCAGGCAGCAGTGGGCGATGG + Exonic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1032743174 7:134759978-134760000 TGGCATTCAGCAGAGATCTAAGG + Intronic
1032901957 7:136320483-136320505 TGGGATACAGCAGTAGTGGTGGG + Intergenic
1033556919 7:142496181-142496203 AGGCAATAAGCAATGGTGGAGGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035303043 7:157910008-157910030 TGGCACTCACTAGTGGTGCAGGG + Intronic
1035920201 8:3668223-3668245 TGAGATCCAGCAGTGGTGGACGG - Intronic
1036121215 8:6019957-6019979 TGGCCTCCAGCAGTGGAGGTGGG + Intergenic
1036756296 8:11473398-11473420 TGTCATTCACCAGTGCTGGGGGG + Intronic
1036796017 8:11757400-11757422 TGGCATACAGCATGGGTGGCAGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037605936 8:20437112-20437134 TGGCTTTCTGCCGTGGTGGCAGG + Intergenic
1037648693 8:20817066-20817088 TGACCAGCAGCAGTGGTGGATGG + Intergenic
1038622026 8:29153447-29153469 TGGCATTCAACAGAAGTGGTGGG + Intronic
1038759512 8:30373655-30373677 TGACATTCAGTAGAGGTGGGTGG - Intergenic
1039360011 8:36866006-36866028 TGGTTTTCAGAAGTGGTGGGTGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040891933 8:52326254-52326276 TGGCCTGCAGCAGTGGGGAAGGG + Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1044994050 8:97822003-97822025 TGTCATTCAGCAGTTAAGGATGG + Intronic
1045328716 8:101137035-101137057 TTGCATTCACAAATGGTGGAGGG + Intergenic
1045357372 8:101401809-101401831 TGGCACTCAGCAGGTGTGAAAGG + Intergenic
1045510242 8:102807551-102807573 TGGCATTCAAAAGAGGTGGGAGG + Intergenic
1045521803 8:102909944-102909966 TGGCATTCTGCAGAGCTGAAAGG - Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048100260 8:131343232-131343254 TGGTGATCAGCAGCGGTGGACGG + Intergenic
1050067598 9:1777001-1777023 TGGCAACCAGCAGTGGGAGATGG - Intergenic
1050116061 9:2264607-2264629 AGGCAATCAGCAGCAGTGGATGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1052733797 9:32319477-32319499 TGCCCTTCAGCAGTGATGAATGG + Intergenic
1053114885 9:35491373-35491395 AGATATTAAGCAGTGGTGGATGG + Intronic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053164549 9:35835258-35835280 GGGAATTCAGCAGAGATGGAAGG - Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056295152 9:85185484-85185506 TGGCATCAAGCAGCTGTGGAAGG - Intergenic
1058288320 9:103207389-103207411 TGGCATTCAGAAATGATGGCTGG + Intergenic
1059067999 9:111105344-111105366 TGACAATCAGTATTGGTGGAGGG - Intergenic
1059287723 9:113190488-113190510 TGGAATCCAGCTGTGGTGGAAGG + Exonic
1059534720 9:115070063-115070085 TGGGATTCAGCAGTGGATGATGG + Intronic
1061105776 9:128529303-128529325 TGTCACTGTGCAGTGGTGGAGGG - Intronic
1061370287 9:130193953-130193975 TTTCCTTCAGCTGTGGTGGAGGG + Intronic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1185982867 X:4798841-4798863 TGCCTTTCTGCAATGGTGGAGGG + Intergenic
1187001900 X:15189896-15189918 TGTCAGTCCCCAGTGGTGGATGG + Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191963429 X:66728882-66728904 TGGAATTCAGCAGAGGTCGCTGG - Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193582956 X:83287140-83287162 TGGGTATCAGCAGTGGTGGCTGG - Intergenic
1195146909 X:102027125-102027147 TGGGATCCAGCAGTGGTGGATGG - Intergenic
1195256572 X:103096771-103096793 TGCAATACAGCAGTGGTGAATGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196595937 X:117545585-117545607 TGAGATTCATCAGTGGTTGAAGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198862288 X:141084202-141084224 CGGCCTTCGGCGGTGGTGGACGG - Intergenic
1198862295 X:141084226-141084248 CGGCCTTCGGCGGTGGTGGACGG - Intergenic
1198862308 X:141084274-141084296 CGGCCTTCGGCGGTGGTGGACGG - Intergenic
1198862326 X:141084345-141084367 CGGCGTTCAGCGGTGGTGGACGG - Intergenic
1198900368 X:141503041-141503063 CGGCGTTCAGCGGTGGTGGACGG + Intergenic
1198900382 X:141503098-141503120 CGGCCTTCGGCGGTGGTGGACGG + Intergenic
1198900395 X:141503146-141503168 CGGCCTTCGGCGGTGGTGGACGG + Intergenic
1198900402 X:141503170-141503192 CGGCCTTCGGCGGTGGTGGACGG + Intergenic
1199100763 X:143797005-143797027 TGGGATGCAGCAGTTGAGGAAGG + Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200415982 Y:2910352-2910374 CGGCGATCAGCAGTGGTGAACGG + Intronic
1200851945 Y:7892248-7892270 TAGCATTCAGTAGTGGTGGATGG + Intergenic
1201255134 Y:12099985-12100007 TGGCATTCTCCCATGGTGGAAGG + Intergenic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201455862 Y:14166266-14166288 AGGCATTCATCAGTGGGGGGGGG - Intergenic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic
1202195413 Y:22295280-22295302 TGGCATGCAGGAATGGTAGAGGG - Intergenic